ID: 963768214

View in Genome Browser
Species Human (GRCh38)
Location 3:149361054-149361076
Sequence TGGTGGTTAAGGAGGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963768202_963768214 15 Left 963768202 3:149361016-149361038 CCAATGGAAGAGTGGAAGATGGG No data
Right 963768214 3:149361054-149361076 TGGTGGTTAAGGAGGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963768214 Original CRISPR TGGTGGTTAAGGAGGGCCCA GGG Intergenic
No off target data available for this crispr