ID: 963775062

View in Genome Browser
Species Human (GRCh38)
Location 3:149430417-149430439
Sequence ATGTTTAAACAGAAGCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963775062_963775064 14 Left 963775062 3:149430417-149430439 CCATCTGGCTTCTGTTTAAACAT No data
Right 963775064 3:149430454-149430476 ACACTACCATTTCCATTTCAAGG No data
963775062_963775065 15 Left 963775062 3:149430417-149430439 CCATCTGGCTTCTGTTTAAACAT No data
Right 963775065 3:149430455-149430477 CACTACCATTTCCATTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963775062 Original CRISPR ATGTTTAAACAGAAGCCAGA TGG (reversed) Intergenic
No off target data available for this crispr