ID: 963777177

View in Genome Browser
Species Human (GRCh38)
Location 3:149451427-149451449
Sequence CAAGATACAATGGGGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963777171_963777177 16 Left 963777171 3:149451388-149451410 CCTATGAGCCTGCAAAATCAAAA 0: 57
1: 1870
2: 2304
3: 1540
4: 1065
Right 963777177 3:149451427-149451449 CAAGATACAATGGGGGAGCTTGG No data
963777170_963777177 23 Left 963777170 3:149451381-149451403 CCTTCTACCTATGAGCCTGCAAA 0: 5
1: 151
2: 1749
3: 2154
4: 1648
Right 963777177 3:149451427-149451449 CAAGATACAATGGGGGAGCTTGG No data
963777172_963777177 8 Left 963777172 3:149451396-149451418 CCTGCAAAATCAAAAACAAGTTA 0: 6
1: 366
2: 2148
3: 2277
4: 1816
Right 963777177 3:149451427-149451449 CAAGATACAATGGGGGAGCTTGG No data
963777169_963777177 24 Left 963777169 3:149451380-149451402 CCCTTCTACCTATGAGCCTGCAA 0: 5
1: 139
2: 1614
3: 2022
4: 1483
Right 963777177 3:149451427-149451449 CAAGATACAATGGGGGAGCTTGG No data
963777168_963777177 25 Left 963777168 3:149451379-149451401 CCCCTTCTACCTATGAGCCTGCA No data
Right 963777177 3:149451427-149451449 CAAGATACAATGGGGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963777177 Original CRISPR CAAGATACAATGGGGGAGCT TGG Intergenic
No off target data available for this crispr