ID: 963777519

View in Genome Browser
Species Human (GRCh38)
Location 3:149453897-149453919
Sequence ATGTATGTGCACAAAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963777506_963777519 30 Left 963777506 3:149453844-149453866 CCAAGATTCAAGAAGGAGGAGGG No data
Right 963777519 3:149453897-149453919 ATGTATGTGCACAAAGGGAAGGG No data
963777513_963777519 0 Left 963777513 3:149453874-149453896 CCACCTCTCCATAGGGGAATGGC No data
Right 963777519 3:149453897-149453919 ATGTATGTGCACAAAGGGAAGGG No data
963777515_963777519 -8 Left 963777515 3:149453882-149453904 CCATAGGGGAATGGCATGTATGT No data
Right 963777519 3:149453897-149453919 ATGTATGTGCACAAAGGGAAGGG No data
963777514_963777519 -3 Left 963777514 3:149453877-149453899 CCTCTCCATAGGGGAATGGCATG No data
Right 963777519 3:149453897-149453919 ATGTATGTGCACAAAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963777519 Original CRISPR ATGTATGTGCACAAAGGGAA GGG Intergenic
No off target data available for this crispr