ID: 963778499

View in Genome Browser
Species Human (GRCh38)
Location 3:149464029-149464051
Sequence ACCTGCGTGATGCACTACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963778499_963778502 -4 Left 963778499 3:149464029-149464051 CCGGTGTAGTGCATCACGCAGGT No data
Right 963778502 3:149464048-149464070 AGGTCTGGCCGCGCTTCAGGAGG No data
963778499_963778501 -7 Left 963778499 3:149464029-149464051 CCGGTGTAGTGCATCACGCAGGT No data
Right 963778501 3:149464045-149464067 CGCAGGTCTGGCCGCGCTTCAGG No data
963778499_963778503 -3 Left 963778499 3:149464029-149464051 CCGGTGTAGTGCATCACGCAGGT No data
Right 963778503 3:149464049-149464071 GGTCTGGCCGCGCTTCAGGAGGG No data
963778499_963778507 15 Left 963778499 3:149464029-149464051 CCGGTGTAGTGCATCACGCAGGT No data
Right 963778507 3:149464067-149464089 GAGGGTGTGCGCGTCTCCTGGGG No data
963778499_963778508 21 Left 963778499 3:149464029-149464051 CCGGTGTAGTGCATCACGCAGGT No data
Right 963778508 3:149464073-149464095 GTGCGCGTCTCCTGGGGCGATGG No data
963778499_963778506 14 Left 963778499 3:149464029-149464051 CCGGTGTAGTGCATCACGCAGGT No data
Right 963778506 3:149464066-149464088 GGAGGGTGTGCGCGTCTCCTGGG No data
963778499_963778505 13 Left 963778499 3:149464029-149464051 CCGGTGTAGTGCATCACGCAGGT No data
Right 963778505 3:149464065-149464087 AGGAGGGTGTGCGCGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963778499 Original CRISPR ACCTGCGTGATGCACTACAC CGG (reversed) Intergenic
No off target data available for this crispr