ID: 963778513

View in Genome Browser
Species Human (GRCh38)
Location 3:149464102-149464124
Sequence CGCAGCCGCCATGGGAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963778513_963778527 30 Left 963778513 3:149464102-149464124 CCTGCACTCCCATGGCGGCTGCG No data
Right 963778527 3:149464155-149464177 GGCGTGGACTCACAGCGACCTGG No data
963778513_963778523 5 Left 963778513 3:149464102-149464124 CCTGCACTCCCATGGCGGCTGCG No data
Right 963778523 3:149464130-149464152 TGGGTGGGCAGGCAGCGCGAGGG No data
963778513_963778525 9 Left 963778513 3:149464102-149464124 CCTGCACTCCCATGGCGGCTGCG No data
Right 963778525 3:149464134-149464156 TGGGCAGGCAGCGCGAGGGGCGG No data
963778513_963778520 -10 Left 963778513 3:149464102-149464124 CCTGCACTCCCATGGCGGCTGCG No data
Right 963778520 3:149464115-149464137 GGCGGCTGCGGACGCTGGGTGGG No data
963778513_963778524 6 Left 963778513 3:149464102-149464124 CCTGCACTCCCATGGCGGCTGCG No data
Right 963778524 3:149464131-149464153 GGGTGGGCAGGCAGCGCGAGGGG No data
963778513_963778521 -6 Left 963778513 3:149464102-149464124 CCTGCACTCCCATGGCGGCTGCG No data
Right 963778521 3:149464119-149464141 GCTGCGGACGCTGGGTGGGCAGG No data
963778513_963778526 14 Left 963778513 3:149464102-149464124 CCTGCACTCCCATGGCGGCTGCG No data
Right 963778526 3:149464139-149464161 AGGCAGCGCGAGGGGCGGCGTGG No data
963778513_963778522 4 Left 963778513 3:149464102-149464124 CCTGCACTCCCATGGCGGCTGCG No data
Right 963778522 3:149464129-149464151 CTGGGTGGGCAGGCAGCGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963778513 Original CRISPR CGCAGCCGCCATGGGAGTGC AGG (reversed) Intergenic