ID: 963780113

View in Genome Browser
Species Human (GRCh38)
Location 3:149478695-149478717
Sequence GGCCAGGGTCGACCACATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963780101_963780113 24 Left 963780101 3:149478648-149478670 CCAGCTGTGCCAGATTGTAAACC 0: 1
1: 0
2: 0
3: 4
4: 88
Right 963780113 3:149478695-149478717 GGCCAGGGTCGACCACATGCTGG 0: 1
1: 0
2: 0
3: 5
4: 75
963780103_963780113 15 Left 963780103 3:149478657-149478679 CCAGATTGTAAACCAAGGCACCT 0: 1
1: 0
2: 0
3: 7
4: 83
Right 963780113 3:149478695-149478717 GGCCAGGGTCGACCACATGCTGG 0: 1
1: 0
2: 0
3: 5
4: 75
963780108_963780113 -5 Left 963780108 3:149478677-149478699 CCTAGCACGGCTGCCCTGGGCCA 0: 1
1: 0
2: 4
3: 40
4: 330
Right 963780113 3:149478695-149478717 GGCCAGGGTCGACCACATGCTGG 0: 1
1: 0
2: 0
3: 5
4: 75
963780105_963780113 3 Left 963780105 3:149478669-149478691 CCAAGGCACCTAGCACGGCTGCC 0: 1
1: 0
2: 2
3: 10
4: 137
Right 963780113 3:149478695-149478717 GGCCAGGGTCGACCACATGCTGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963780113 Original CRISPR GGCCAGGGTCGACCACATGC TGG Intronic
900345624 1:2209003-2209025 GGCCAGGGTGGAGCAGCTGCTGG - Intronic
900352537 1:2242426-2242448 GGCCACGGTAGGCCACATCCCGG - Intronic
900568262 1:3345960-3345982 GGCCAGGGTCTCCCCCATCCAGG + Intronic
900882624 1:5392945-5392967 GGTCAGGGTGGATCCCATGCTGG + Intergenic
901914172 1:12485409-12485431 GGCCAAGGGCCACCAAATGCAGG - Intronic
906203782 1:43976110-43976132 GCCCAGGTTGGACCACATGAAGG - Exonic
910872270 1:91845663-91845685 GGTCAGGGTATACTACATGCAGG - Intronic
912217241 1:107628430-107628452 GGCCAGGGGCAACCAGGTGCTGG - Intronic
917362647 1:174194082-174194104 GGTCAGTGTTGACCCCATGCTGG - Intronic
918174906 1:182035257-182035279 GGCCAGGCTCCTCCCCATGCAGG + Intergenic
921214977 1:212928923-212928945 GGCCAGGGCCGAGCAGCTGCAGG + Intergenic
1067427551 10:46221274-46221296 GGGCAGGCTCCTCCACATGCTGG + Intergenic
1068754494 10:60635870-60635892 GGCCAGGGATGTCCACAAGCAGG + Intronic
1071377575 10:85024583-85024605 TGCAGGGGTCGACTACATGCAGG - Intergenic
1075653386 10:124145015-124145037 GGCCTGGGATCACCACATGCAGG + Intergenic
1076475783 10:130750566-130750588 GACCAGGGTGGAACACAGGCAGG - Intergenic
1076531486 10:131147972-131147994 GCCCAGGGTTGCCAACATGCAGG - Intronic
1077144050 11:1036964-1036986 GGCCAGGATGGCCCCCATGCAGG - Intergenic
1083934323 11:65862450-65862472 GGCCAGGGTCGAGCACTCCCAGG - Exonic
1084582049 11:70030107-70030129 GGCCAGGGCCTCCCACAAGCAGG - Intergenic
1094493632 12:30976409-30976431 GTCCAGGCTCCACCACATGCTGG - Intronic
1100744084 12:97626287-97626309 GGCCAGTGTCTATCCCATGCTGG + Intergenic
1101952185 12:109185783-109185805 ATCCAGGGTCCCCCACATGCTGG - Intronic
1108268071 13:48732193-48732215 GGCCAGGCTAGACCAAGTGCCGG - Intergenic
1123055060 14:105565766-105565788 GAACAGGGTGGACCACATGGGGG - Intergenic
1123079508 14:105685610-105685632 GAACAGGGTGGACCACATGGGGG - Intergenic
1132573978 16:656399-656421 GTCCCGGGTGTACCACATGCTGG + Exonic
1139303613 16:65964946-65964968 GGCCAGGTGTGACCACATGGGGG + Intergenic
1139591493 16:67935710-67935732 GGGCGGGGTCGGCCACAAGCTGG + Intronic
1141429763 16:83965521-83965543 GGCCAGGGTCGTCCACGGCCCGG - Exonic
1141625537 16:85259286-85259308 GGCCAGGGTGGAGCACAGGGTGG - Intergenic
1141625545 16:85259308-85259330 GGCCAGGGTGGAGCACAGGGTGG - Intergenic
1142263704 16:89054034-89054056 GGCCAGGGTCGGCCGCCTTCAGG - Intergenic
1142425770 16:90001526-90001548 GGCCAGGGGCAGCCACGTGCTGG - Intergenic
1142971576 17:3615358-3615380 GGCCACGTTCGTCCACATGCTGG - Exonic
1144632020 17:16878682-16878704 GACCAGGGACGCCCCCATGCAGG - Intergenic
1145209005 17:20999491-20999513 GACCAGGGACGCCCCCATGCAGG + Intergenic
1147625452 17:41897049-41897071 GGCACGGGTCAACCCCATGCTGG - Intronic
1149638595 17:58189349-58189371 GGTCAGGGCCAACCACATGCAGG - Intergenic
1151361936 17:73594143-73594165 GGCCAGAGTGAACCACCTGCTGG - Intronic
1151377850 17:73703541-73703563 TGACAGGGTAGAGCACATGCGGG - Intergenic
1151849599 17:76682643-76682665 TGCGAGGGGCAACCACATGCAGG + Intronic
1154414892 18:14171376-14171398 GGCCAGGGCAGGCCAAATGCAGG + Intergenic
1160554665 18:79717572-79717594 AGTCAGGGTTGACCACGTGCAGG - Exonic
1162588543 19:11576374-11576396 GGCCAGGGAGGACTACGTGCTGG - Exonic
1162800498 19:13107724-13107746 GGGCAGGGCTGACCTCATGCAGG - Intronic
1166299042 19:41903932-41903954 GGCCGGGGATGACCACAGGCTGG - Intronic
1168538564 19:57191833-57191855 GGCCAGGGTCGGGCACAGGTGGG + Exonic
925257440 2:2502282-2502304 GGCCAGAGTGCACCACATACAGG - Intergenic
940594173 2:155768202-155768224 CACCAGGGTAGACCACATTCTGG - Intergenic
948445340 2:238028188-238028210 GACCAGTGGCCACCACATGCTGG + Intronic
949032415 2:241803281-241803303 GGCCAGGGTGGCCCACCCGCGGG - Intronic
1172982273 20:38952379-38952401 GTCCCGGCTCAACCACATGCTGG + Exonic
1179411895 21:41168497-41168519 GGCCATGGTAGACAACCTGCAGG + Exonic
1183420861 22:37710525-37710547 GGCCTGGGTCCACCACAGACTGG - Exonic
1183662716 22:39230862-39230884 GGCCAGCCTCGCCCACAGGCTGG - Intronic
1184643713 22:45885276-45885298 GGGGAGGGGCGGCCACATGCAGG - Intergenic
954731142 3:52663275-52663297 GGTCAGGGTCTACCAGAAGCTGG + Intronic
961101369 3:124201972-124201994 GGCCAGGCTGGGCCAGATGCTGG + Intronic
961402664 3:126658091-126658113 GGCCAGGCTGGGCCAGATGCTGG + Intergenic
962893159 3:139690693-139690715 GGCCAGTGTCAAGCACATGAAGG + Intergenic
963780113 3:149478695-149478717 GGCCAGGGTCGACCACATGCTGG + Intronic
968737322 4:2304157-2304179 GGCCAGGGCCCAGCACCTGCCGG + Intronic
969317311 4:6390041-6390063 GGCTAGGGTCTCCCACCTGCAGG - Intronic
972083347 4:35182180-35182202 GGCCATGGGAGAGCACATGCAGG - Intergenic
977800104 4:101217914-101217936 GGCCTGTGTCTACCCCATGCAGG - Intronic
1004067426 6:12262402-12262424 AGTCAAGGTCGACCAGATGCAGG + Intergenic
1007999566 6:46345479-46345501 TGCCATGGTAGACCACATGTTGG + Intronic
1017811593 6:157987902-157987924 GGGAAGGGTCGACCACAGCCTGG + Intronic
1019645035 7:2124514-2124536 GGCTGGGGTGGGCCACATGCAGG - Intronic
1023644089 7:42291395-42291417 GGCCTGGCTTGAGCACATGCTGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1025086716 7:56029329-56029351 GGCCAGGGTAGAAGACATGCCGG + Intronic
1029112793 7:98222288-98222310 GGCCAGGGTCCCCCAGAAGCTGG - Intronic
1034972121 7:155425890-155425912 GGCCAGAGTCTCCCACATGTGGG - Intergenic
1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG + Intergenic
1045112681 8:98949045-98949067 GGCCACGGTGGACCACCTGCAGG + Exonic
1051500212 9:17768543-17768565 GCACAGGGGCCACCACATGCTGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1186352710 X:8756663-8756685 GGCAAAGGTTGACCACATTCTGG + Intergenic
1189139900 X:38592307-38592329 AGCAAGGGTCAACTACATGCTGG - Intronic