ID: 963781998

View in Genome Browser
Species Human (GRCh38)
Location 3:149495694-149495716
Sequence CTGTGTGACTAGCAGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963781998_963782002 10 Left 963781998 3:149495694-149495716 CCCCTCTGCTGCTAGTCACACAG 0: 1
1: 0
2: 3
3: 23
4: 216
Right 963782002 3:149495727-149495749 TTCCAAGTTTGCTGAGCTGAAGG 0: 1
1: 4
2: 21
3: 27
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963781998 Original CRISPR CTGTGTGACTAGCAGCAGAG GGG (reversed) Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900607175 1:3529051-3529073 CTGTGTGACCAGCCCCACAGAGG - Intronic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
903591414 1:24458679-24458701 CTGTGTGTCTAGGGGAAGAGTGG + Intronic
904277006 1:29391313-29391335 CCCAGTGACTAGCAGCAGACAGG - Intergenic
904577391 1:31513900-31513922 TGGGATGACTAGCAGCAGAGAGG - Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
907787960 1:57632439-57632461 CTATGAGACTAGAAGCAGAGAGG + Intronic
909053051 1:70790639-70790661 CTGTGGGACAACCTGCAGAGTGG + Intergenic
909764196 1:79334322-79334344 CTGTGTGACTGGGAGGAGACTGG + Intergenic
911540054 1:99146864-99146886 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
912391212 1:109304475-109304497 CTGTGTGCCTCTCAGCAAAGAGG - Intronic
912391475 1:109306234-109306256 CTGTGTGCCTCTCAGCAAAGAGG - Intronic
912848324 1:113097945-113097967 TTGTGTGATTAGCAGTAAAGAGG - Intronic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
920386655 1:205574812-205574834 CTGTGTGCCTAGCACCATGGTGG + Intronic
922062528 1:222105955-222105977 CAGTGGGACTGGAAGCAGAGAGG - Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
924105513 1:240645291-240645313 CTGTGAGACTAGAAGCAAGGTGG + Intergenic
924431957 1:244004854-244004876 CTGTGTGTGTAGCTGAAGAGAGG + Intergenic
1062853020 10:759899-759921 CTGTGGTAGTAGCAGCAGGGTGG - Intergenic
1064349720 10:14565946-14565968 CTGTGGAACTCGCAGCAGGGCGG + Intronic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1067429708 10:46234902-46234924 CTGTGTGGCTTGCAGCTGTGTGG - Intergenic
1067443946 10:46329024-46329046 CTGTGTGGCTTGCAGCTGTGTGG + Intronic
1067691701 10:48505937-48505959 CTGCGTGACTAGCCAGAGAGGGG - Intronic
1068244553 10:54347686-54347708 CTCTCTGAGTAGCATCAGAGAGG - Intronic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1069776131 10:70928346-70928368 CCGTGTGACTAGCAGCTTAATGG - Intergenic
1072696440 10:97607230-97607252 CTGTGTGTCTGGCAGCAGGTGGG + Intronic
1073329094 10:102659342-102659364 CTCTGTGACAAGCAGCAGGGAGG - Intergenic
1073584313 10:104693978-104694000 CTGTGTGTCTTGCTGAAGAGAGG - Intronic
1073998752 10:109345943-109345965 GTGTGGGACTAGAAGCAGGGAGG - Intergenic
1074696132 10:116051550-116051572 CTGTCTGACCAGTGGCAGAGGGG - Intergenic
1075326187 10:121533961-121533983 CTGTTGGACTTGCAGGAGAGGGG - Intronic
1075941708 10:126395688-126395710 CTGGGGGACTTGCAGCAGTGGGG - Intergenic
1076066812 10:127455268-127455290 CAGTGTCACTAGCTGGAGAGGGG + Intergenic
1077640394 11:3876351-3876373 CTGTTTGGGTAGCAGCTGAGAGG + Intronic
1077867234 11:6233315-6233337 ATGGCTGACTAGCAGTAGAGAGG + Intronic
1080393655 11:31871010-31871032 CTGTGTGGCCAGGAGGAGAGAGG + Intronic
1080588566 11:33701773-33701795 GTGTGTGTGTAGCAGCAAAGTGG + Intronic
1083616685 11:64029677-64029699 CTGTGTGACGAGCAGCTCATGGG - Intronic
1083904055 11:65658717-65658739 CTGTGTGACAAGGTGCAGAAAGG - Exonic
1084085303 11:66852375-66852397 CTGTGGGACTGGCCACAGAGCGG + Intronic
1084344391 11:68535253-68535275 CTGTTAGCCTAGCAGCATAGTGG + Intronic
1088332205 11:108665503-108665525 CAGTGTGGCAAGCAGAAGAGTGG - Intronic
1090136982 11:124209397-124209419 CTGGGTGACCACCTGCAGAGAGG - Intergenic
1094219873 12:27980626-27980648 CCGTGTAATTAGCAGAAGAGAGG - Intergenic
1096925079 12:55135335-55135357 CTGTCTGGCTACCAGCAGAAGGG - Intergenic
1098928764 12:76384543-76384565 CTATGTGACTACCAGGAGGGTGG - Intronic
1101824604 12:108210326-108210348 CTGAGGGAGGAGCAGCAGAGAGG - Intronic
1102051325 12:109864162-109864184 CTGGGAGCCTAGCAGAAGAGAGG + Intronic
1103188138 12:118979628-118979650 CTGAGTCACTTGCAGGAGAGAGG - Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1107187874 13:37546058-37546080 CCTGGTGACTAGCAGCAGTGGGG + Intergenic
1107233173 13:38136283-38136305 CTGTCTAGCTAGCAGCAGATGGG - Intergenic
1107975441 13:45683894-45683916 CAGTGTGTCTGGAAGCAGAGAGG - Intergenic
1110160790 13:72375918-72375940 GTGTTTGAGTAACAGCAGAGAGG + Intergenic
1112829163 13:103427523-103427545 CTGTGTGCTTAGAAGAAGAGGGG + Intergenic
1113391625 13:109903400-109903422 CTGAGGGAATAGCAGGAGAGAGG + Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114417709 14:22555465-22555487 CAGTGAGGGTAGCAGCAGAGGGG - Intergenic
1115254392 14:31383704-31383726 CTGTTCGACTAGCAGCAGCTTGG - Exonic
1117514057 14:56482734-56482756 CTGTGACACTGACAGCAGAGAGG - Intergenic
1120176250 14:81296531-81296553 CTGTGTGTCTAGCTGCAAAGGGG - Intronic
1120545918 14:85811243-85811265 GTGTGTGAGGAGCAGCAAAGAGG + Intergenic
1123662571 15:22577269-22577291 CAGTGTGACTGGCAGCAGAAAGG + Intergenic
1124261712 15:28198642-28198664 CAGTGTGACTGGCAGCAGAAAGG - Exonic
1124316373 15:28671570-28671592 CAGTGTGACTGGCAGCAGAAAGG + Intergenic
1124708131 15:31982536-31982558 CTGGGTGTCTAGCATCAGATGGG - Intergenic
1127477462 15:59348200-59348222 TTGTGTGACTAGCACCTGGGGGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128552887 15:68609606-68609628 CTGGGAGACCAGCAGCAAAGAGG - Intronic
1132232630 15:100195217-100195239 CTGTGTGAGAAGCTGCAGAGGGG - Intronic
1133015505 16:2937727-2937749 CCGTGAGACTAGAAGCAGTGTGG - Intronic
1133692371 16:8229206-8229228 CTTTGTCAGTAGCAGCACAGGGG + Intergenic
1134770882 16:16808495-16808517 CTGTGTGTCTAAAAGGAGAGGGG + Intergenic
1135037979 16:19094262-19094284 CAGTGTGACTGTCAGCAGAGAGG + Intergenic
1135976814 16:27113817-27113839 CTTTGGGACCAGCAGCAGTGGGG - Intergenic
1136067162 16:27766998-27767020 CTGAGTGAGAAGCAGCAGGGGGG + Intronic
1137334297 16:47533188-47533210 CGGGATGACTAGCTGCAGAGAGG - Intronic
1138095907 16:54211411-54211433 GTCTGTGACTAGCAGCAGGGAGG - Intergenic
1138990700 16:62387502-62387524 CTCTGTGACTAGCAGCTGTGAGG - Intergenic
1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG + Intergenic
1140327128 16:74015262-74015284 CTGGGTGATTTGCAGAAGAGAGG - Intergenic
1141492444 16:84383236-84383258 CTGTGTGTCTAGAGGCAGACAGG + Intronic
1142020141 16:87777163-87777185 CAGAGTGTCTGGCAGCAGAGAGG - Intergenic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1144774579 17:17778846-17778868 CTGAGTGACTAGAAGCCAAGAGG + Intronic
1146559660 17:33857183-33857205 CTGGTTGACCAGCAGCAGAAAGG - Intronic
1147503712 17:40992440-40992462 CTGGGTGATTAGAAGCTGAGTGG - Intergenic
1147635727 17:41962718-41962740 CTGTGTCACTAGAAACAGTGTGG - Intronic
1147892808 17:43729196-43729218 GTGTGTTGTTAGCAGCAGAGGGG + Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1150454355 17:65294785-65294807 ATGAGTGAGTGGCAGCAGAGAGG - Intergenic
1150951005 17:69802056-69802078 CTGTGTAGCTCTCAGCAGAGAGG - Intergenic
1151512970 17:74572908-74572930 CTGGGTGACAAGAAGCAGTGAGG + Intergenic
1154015748 18:10615420-10615442 ATGTGTGACTAGGAACAGGGAGG + Intergenic
1154189762 18:12220222-12220244 ATGTGTGACTAGGAACAGGGAGG - Intergenic
1156795875 18:41045582-41045604 CTGTGTGTCTGGAAGCAGAATGG - Intergenic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1160596238 18:79976406-79976428 CTGGGTCTCTGGCAGCAGAGTGG + Intronic
1162018628 19:7858630-7858652 CTGTGTCACAGGCAGCAGACAGG + Intronic
1162263650 19:9552510-9552532 CAGTGCCACTAGCAGAAGAGAGG - Intergenic
1162468073 19:10854723-10854745 CTGTGTGACTAGCTTCTGGGTGG + Intronic
1166567880 19:43776236-43776258 CTGAGTGCCTGGGAGCAGAGTGG + Intronic
925640269 2:5980583-5980605 CTGAGTGAATGGAAGCAGAGTGG - Intergenic
925837784 2:7962748-7962770 CTGTGTGTCTAACATCACAGTGG + Intergenic
927209610 2:20630952-20630974 CTGAGAGAGGAGCAGCAGAGGGG + Intronic
931056150 2:58473713-58473735 CTGTGGGGCTGTCAGCAGAGGGG - Intergenic
931898176 2:66757081-66757103 TTATGTGAGTAGCAGCACAGTGG - Intergenic
934619823 2:95797268-95797290 CTGTATGGCTCGGAGCAGAGAGG - Intergenic
934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG + Intronic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
935250995 2:101260548-101260570 CTGGGTGGCTAGCTCCAGAGTGG - Intronic
939167716 2:138657101-138657123 CTGTTTGAGTATCAGCATAGGGG - Intergenic
939465335 2:142547352-142547374 CTCTGTGCCAAGCAGGAGAGAGG - Intergenic
939967130 2:148621356-148621378 GTGTGTGGCCTGCAGCAGAGGGG - Intergenic
941141419 2:161788269-161788291 CTGTGTGACTAGGAGAGCAGAGG + Intronic
944650889 2:201829242-201829264 CTGTGTGAGTAGGGGGAGAGAGG - Intronic
944881666 2:204018963-204018985 CTCTGTGACGAGGAGCAGGGTGG + Intergenic
944901768 2:204223201-204223223 CAGGGTGACCAACAGCAGAGAGG - Intergenic
945730753 2:213530258-213530280 TTCTGTGACTGGCAGCACAGTGG + Intronic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
947501690 2:230675558-230675580 CAGTGTGACTGGCTGCAGAGGGG + Intergenic
948332862 2:237183884-237183906 CTGTGTCATTGGCAGCAGATGGG - Intergenic
948806368 2:240455047-240455069 CTTAGTGAGGAGCAGCAGAGTGG + Intronic
1168820097 20:767061-767083 CTGGGTGGCTACCAACAGAGAGG + Intronic
1169311624 20:4547067-4547089 CTGTGTGTCTATGAGAAGAGCGG - Intergenic
1172027039 20:31955579-31955601 TTGTGTGAGCAGCAGCAGGGAGG - Intergenic
1172410114 20:34714954-34714976 GTGTGTGAATAGCAGTAGTGGGG - Exonic
1173664216 20:44753557-44753579 CTGTTTGAAGAGGAGCAGAGAGG - Intronic
1175027126 20:55914201-55914223 CTGTGTGACTTGGAGAGGAGGGG + Intergenic
1175064395 20:56272742-56272764 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
1176411266 21:6450737-6450759 CAGTGTGACAGGCAGGAGAGCGG - Intergenic
1176411279 21:6450786-6450808 CAGTGTGACAGGCAGGAGAGCGG - Intergenic
1176719569 21:10382162-10382184 CTGGGAGACTAGCAGAAGAGAGG + Intergenic
1179354890 21:40649986-40650008 CTGTGAGATGAGCAGCACAGAGG + Intronic
1179686759 21:43059059-43059081 CAGTGTGACAGGCAGGAGAGCGG - Intronic
1179686772 21:43059108-43059130 CAGTGTGACAGGCAGGAGAGCGG - Intronic
1180300806 22:11035136-11035158 CTGGGGGACTAGCAGAAGAGAGG + Intergenic
1180758314 22:18178726-18178748 ATGTGTGACTAGGAACAGGGAGG + Intergenic
1180768602 22:18362518-18362540 ATGTGTGACTAGGAACAGGGAGG + Intergenic
1180777709 22:18499873-18499895 ATGTGTGACTAGGAACAGGGAGG - Intergenic
1180810434 22:18757184-18757206 ATGTGTGACTAGGAACAGGGAGG - Intergenic
1180826477 22:18865742-18865764 ATGTGTGACTAGGAACAGGGAGG + Intergenic
1181196578 22:21191439-21191461 ATGTGTGACTAGGAACAGGGAGG - Intergenic
1181212950 22:21301685-21301707 ATGTGTGACTAGGAACAGGGAGG + Intergenic
1181441825 22:22940511-22940533 ATGTGTCAGTGGCAGCAGAGTGG - Intergenic
1181523598 22:23464697-23464719 ATGTGTGACTAGAAACAGGGAGG + Intergenic
1181677609 22:24466853-24466875 TGTTGTGACAAGCAGCAGAGAGG + Intergenic
1182424233 22:30263763-30263785 CTCAGTGGCTAGTAGCAGAGGGG + Exonic
1184054224 22:42033649-42033671 CTCTGTGGCTCTCAGCAGAGAGG + Intronic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1203230220 22_KI270731v1_random:103406-103428 ATGTGTGACTAGGAACAGGGAGG + Intergenic
1203276620 22_KI270734v1_random:91648-91670 ATGTGTGACTAGGAACAGGGAGG + Intergenic
950004855 3:9685109-9685131 CTGTGTCACTGGCACCAGCGTGG - Intronic
950847463 3:16028825-16028847 CTGAGTGAGAAGTAGCAGAGAGG - Intergenic
951436470 3:22670726-22670748 CTGTGTGAGCCTCAGCAGAGAGG + Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953754688 3:45636154-45636176 CTGTGTGAAATGCAGCAAAGGGG + Exonic
954301094 3:49701227-49701249 CTGTGGGACAAGCTGGAGAGAGG - Intronic
959931294 3:111986041-111986063 CAGTGTGACTAGCAACAGGCTGG + Intronic
960436033 3:117627949-117627971 CTGTGTGTTTGGCACCAGAGAGG + Intergenic
961077820 3:123998105-123998127 CTGTGTGAGGAGAGGCAGAGGGG - Intergenic
961306750 3:125963230-125963252 CTGTGTGAGGAGAGGCAGAGGGG + Intergenic
963161540 3:142155777-142155799 CTCTGGGACAAGCATCAGAGAGG + Intergenic
963318510 3:143786593-143786615 CTGTATTTCTGGCAGCAGAGAGG - Intronic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
964427970 3:156573113-156573135 CTGTGAGACTAGCAGAAAACAGG - Intergenic
967529930 3:190537311-190537333 CTGTGTGGCAAGAAACAGAGAGG - Intronic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
969909403 4:10429386-10429408 CTGTCTGCCTGGCTGCAGAGAGG + Intergenic
970408099 4:15782867-15782889 CTGTGTGACAGGCAGGAGAGGGG - Intronic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
974442029 4:61931114-61931136 CTGTCTCACTAGCAGAAAAGGGG + Intronic
975715655 4:77203402-77203424 CTGTGTCCCTAGCAGCAGCAGGG + Intronic
977106224 4:92888442-92888464 ATGTGTGACTGTCAGCAGAAAGG - Intronic
978884846 4:113756120-113756142 ATGTATGACTAACAGCTGAGAGG + Intronic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
985336270 4:188898887-188898909 CTGTGAGACTAGCAGGTAAGAGG - Intergenic
987377775 5:17252454-17252476 CTGTGTGCCATGCAGCAGAAAGG + Intronic
987467974 5:18295348-18295370 CCATGTGACCAGCTGCAGAGAGG - Intergenic
989274232 5:39568352-39568374 TTGTGTAACTGGCAGCAGAATGG - Intergenic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
992376483 5:76193011-76193033 CAGTGTAAATAGGAGCAGAGGGG - Intronic
994449914 5:99929274-99929296 CTGCTTGACTCTCAGCAGAGAGG + Intergenic
996954776 5:129169764-129169786 CTGTGTAAATAGCAGTAGTGAGG + Intergenic
998427293 5:142039687-142039709 CTGTGCAACTGGGAGCAGAGAGG - Intergenic
999266680 5:150271125-150271147 CTGTGTGACTAGCAGCAGTCTGG - Intronic
1001687684 5:173606751-173606773 CTGTCTGCCTAGTAGTAGAGAGG + Intergenic
1001720408 5:173852415-173852437 CTGTGTGGCTATCAGCTGCGTGG + Intergenic
1002072385 5:176688001-176688023 TGGGATGACTAGCAGCAGAGAGG - Intergenic
1003700837 6:8462894-8462916 CTGCCTGACTAGCAGTAGTGGGG + Intergenic
1003920239 6:10825963-10825985 CTGGCTGATTAGCAGAAGAGTGG - Intronic
1005219601 6:23571794-23571816 ATGTGTCACATGCAGCAGAGAGG - Intergenic
1005824973 6:29627346-29627368 TTGTGTGACTGGCAGGAGATGGG - Intronic
1007649978 6:43413228-43413250 CCAGGTGACCAGCAGCAGAGAGG + Intergenic
1008757660 6:54816753-54816775 CTGAGTGACTAGAAGAATAGTGG - Intergenic
1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG + Intergenic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1015663748 6:135603931-135603953 CTCTGTGGCTCTCAGCAGAGAGG - Intergenic
1019446264 7:1073189-1073211 CTGTGTGTGAAGCTGCAGAGTGG - Intronic
1019511854 7:1421689-1421711 CTGGGTGACAAGCACCTGAGGGG + Intergenic
1020603692 7:10308119-10308141 CTGTGTGAGTAAAAGCAGAAAGG - Intergenic
1021513234 7:21456498-21456520 CTGTGTGCTTGGCAGCAGACAGG - Intronic
1021788919 7:24180164-24180186 CTGTGTGACTAGAGGAAGACAGG - Intergenic
1022596580 7:31718804-31718826 CTGGGTGCCTAGCAGCAGCTAGG - Intergenic
1022650434 7:32269063-32269085 CTGTGGCAGTAGCAGCACAGAGG + Intronic
1024061324 7:45700694-45700716 CTGTGTCACTTGCAGGAGGGAGG + Intronic
1029493515 7:100884900-100884922 CTGTGTGAGCCACAGCAGAGGGG - Intronic
1029736597 7:102468877-102468899 CTGTGTGACCACCATCAGAGCGG - Exonic
1029868011 7:103656894-103656916 CTGTTTCACTATCAGCAAAGTGG - Intronic
1030243837 7:107359807-107359829 CTGTGTGGCCCTCAGCAGAGAGG - Intronic
1034551679 7:151824631-151824653 CTGTGAGAGGAGCAGGAGAGAGG - Intronic
1034796513 7:154018421-154018443 CTGGGAGACTAGTTGCAGAGTGG - Intronic
1035325064 7:158060507-158060529 CTGTGTCCTTAGCAGAAGAGGGG - Intronic
1038359257 8:26861134-26861156 CTGTGTCACATGCAGCTGAGAGG - Intronic
1038700042 8:29841367-29841389 CTGTGTGGCTGGCAGGAGAGAGG - Intergenic
1043350574 8:79355603-79355625 ATGTGTCAGTGGCAGCAGAGTGG + Intergenic
1043623552 8:82227669-82227691 CTGTGGTAGTAGCAGCAGAGTGG - Intergenic
1043626645 8:82269511-82269533 CTCTGAAGCTAGCAGCAGAGGGG + Intergenic
1048261888 8:132952227-132952249 ATGTGTGTGGAGCAGCAGAGTGG + Intronic
1049175639 8:141190824-141190846 CTCTGTGCCAAGCAGCCGAGGGG - Intronic
1049360757 8:142211595-142211617 CTGGGTGGCAAGCAGCAGAGAGG + Intergenic
1050598922 9:7231178-7231200 CTGTGGGAAGAGGAGCAGAGGGG + Intergenic
1051358775 9:16263665-16263687 CTGAGTGACAAGCAGGGGAGCGG + Intronic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1056378163 9:86034454-86034476 CTTTGTGACCAGCCGCTGAGGGG + Intronic
1057468591 9:95337935-95337957 CTGCGTGGCTCTCAGCAGAGAGG - Intergenic
1058223768 9:102335371-102335393 CTGACTGGCTAGCAGCAGATAGG + Intergenic
1058438372 9:104985247-104985269 CTTTGTAGCTAGCAGCAGAGGGG + Intergenic
1061253408 9:129439612-129439634 CTCTGTGACTATCAGAACAGGGG - Intergenic
1061266416 9:129507873-129507895 CTCTTTGGCCAGCAGCAGAGGGG - Intergenic
1186225510 X:7395156-7395178 CTGTGTGTCTAGCAGTAGAGAGG + Intergenic
1186585057 X:10864529-10864551 GTGTGTGCCTAGCTGAAGAGGGG - Intergenic
1192789644 X:74368778-74368800 CTGTATGTCTAGAAGCAAAGAGG + Intergenic
1196483212 X:116175338-116175360 CTGTGTGAACAACAGCAGAGAGG - Intergenic
1197609520 X:128623091-128623113 CTGGGTGGCCAGCTGCAGAGAGG - Intergenic
1198553570 X:137769330-137769352 CTGTCTGACAAGCCGCAGTGAGG + Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1201595127 Y:15659788-15659810 TTGTGTGCCTAGCAGTAGAGAGG + Intergenic
1202152564 Y:21856629-21856651 CTGTGGGAGCAGCAGCATAGTGG - Intergenic