ID: 963785072

View in Genome Browser
Species Human (GRCh38)
Location 3:149526222-149526244
Sequence GCCATGCTGCCCAACTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963785072 Original CRISPR GCCATGCTGCCCAACTTTCC AGG Intronic
901012620 1:6210084-6210106 GCCATGCTGCCCTCCTTAGCTGG - Intronic
902230706 1:15025654-15025676 GTCATGCTGACTAACTTTCCAGG + Intronic
904998186 1:34647647-34647669 GCCAGCCAGCCCAACTTGCCTGG + Intergenic
905645636 1:39623348-39623370 CCCCTGCTGGCCAACTTTGCGGG - Intergenic
906061961 1:42954700-42954722 GACATGCTGCCAGCCTTTCCAGG - Intronic
911119609 1:94282483-94282505 GCCATGTTGCCCAACCCTCCTGG + Intergenic
914047652 1:144104604-144104626 GCCAAGCCGCCCAACTAGCCAGG - Intergenic
916787416 1:168096673-168096695 GCCATGTGGCCCAAGTCTCCAGG + Exonic
917281487 1:173381398-173381420 GCCATGTTGCCCAACTCCACAGG - Intergenic
917635932 1:176936227-176936249 GCTATCCTGCCCACCTTCCCTGG - Intronic
920318430 1:205097294-205097316 GCCAAGGTGCCCAGCCTTCCGGG + Intronic
1062913414 10:1229251-1229273 GCCATCCAGCCCCACTTTCCTGG - Intronic
1063817924 10:9798294-9798316 GCCATGATGCCCAACTTATGTGG + Intergenic
1066365348 10:34770848-34770870 ACTTTGCTGCCCACCTTTCCGGG - Intronic
1071136981 10:82464901-82464923 GCCCTGCTTCCCAAATCTCCTGG + Intronic
1072440974 10:95454862-95454884 GCCAAGCTTCACAACTTACCTGG + Intronic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1076190866 10:128482522-128482544 GCCGTGCTGCCCCACCTTCCTGG + Intergenic
1077375288 11:2202784-2202806 GCCTGGCTGCCCAAGATTCCAGG + Intergenic
1078064622 11:8069950-8069972 GCCATCCTGCCCCACATCCCAGG - Intronic
1082120887 11:48378557-48378579 GCCAGCTTGCCCCACTTTCCTGG - Intergenic
1084267960 11:68014619-68014641 GCCCTGCTGCCCACCCTGCCGGG - Intronic
1084276207 11:68052185-68052207 TCCATGCAGCTTAACTTTCCTGG - Intergenic
1090412146 11:126516656-126516678 ACCTTGCTTCCCAAGTTTCCAGG + Intronic
1094544214 12:31389356-31389378 GCCATCCTTCCCAATGTTCCTGG + Exonic
1096722341 12:53532586-53532608 TCCATGGTGCCCAACATTCCTGG - Exonic
1099112673 12:78582042-78582064 GCCTTGCTCCCCAACTTCCCTGG - Intergenic
1101431585 12:104631869-104631891 TCCCTGCTCCCCAACTTTCCCGG + Intronic
1101695450 12:107121597-107121619 CCCATGCTTCCTAACTTTTCTGG + Intergenic
1102026470 12:109716596-109716618 GCCCTTCTGCCCACCTCTCCCGG - Intronic
1102625588 12:114233050-114233072 TCCATGCAGCCCAACTTTTTGGG - Intergenic
1102848704 12:116217153-116217175 GTCATGCTGCCTGTCTTTCCTGG - Intronic
1105210327 13:18253535-18253557 GGCAGGCTCCCCACCTTTCCTGG + Intergenic
1109396398 13:61765634-61765656 TCCGGGCTGCCCAAGTTTCCGGG - Intergenic
1110326030 13:74216468-74216490 ACCATGCTGCCCAATTTTCAGGG - Intergenic
1110920895 13:81083761-81083783 GCAATACTGCACAACTTTCTAGG - Intergenic
1113125383 13:106972576-106972598 CCTATGCTGCCCAAATTTCATGG + Intergenic
1113457388 13:110458259-110458281 GCCTTGCTGCCCAACTCCCTGGG + Intronic
1113697019 13:112354146-112354168 GCCTTGGGGCCCCACTTTCCAGG - Intergenic
1114287365 14:21257768-21257790 GCTATGTTGCCAGACTTTCCTGG + Intronic
1115036035 14:28857839-28857861 ACCATGCTGCCCCACTCTTCTGG - Intergenic
1116949449 14:50865602-50865624 GCCATCCTGTCCAAGTCTCCTGG + Intronic
1117951714 14:61089576-61089598 GCAATGTTGCCCCTCTTTCCTGG + Intergenic
1118776664 14:68978203-68978225 ACCGAGCTGCCCACCTTTCCCGG + Intronic
1120308514 14:82801281-82801303 GTCATGGTGCCCAACATCCCAGG + Intergenic
1122144753 14:99682980-99683002 GCTCTGCTGCCCACCTGTCCAGG + Intergenic
1122261042 14:100523250-100523272 GCCCTGCTGCCCACATTTCTGGG - Intronic
1124865599 15:33487546-33487568 GCCTTGCTGCCCAACATTTTGGG + Intronic
1128333600 15:66771990-66772012 GACATGCTGCCCATCTTCCTAGG - Intronic
1131354340 15:91731709-91731731 GCCATGCTGCCCCACATGCTGGG - Intergenic
1133177295 16:4025028-4025050 GCCCTGCTGGCCCACTTCCCTGG - Intronic
1134029409 16:10979688-10979710 GCGATGCAGCCCACATTTCCAGG - Intronic
1134665245 16:16013943-16013965 GCCCTGATGCTCAACGTTCCCGG - Intronic
1135508284 16:23058635-23058657 GCCTTCCTGCCCTACATTCCAGG + Intergenic
1139146242 16:64328779-64328801 GCTATTCTCCCCAATTTTCCTGG - Intergenic
1139613283 16:68074125-68074147 TCCATGCTGCCCAGTCTTCCCGG + Exonic
1141233650 16:82195209-82195231 GCCATGGTGCCCGACCCTCCTGG + Intergenic
1142197780 16:88746662-88746684 GAGATGCTGCCCAGTTTTCCGGG - Intronic
1142691061 17:1606281-1606303 GCCATCCTGCCCTCCTCTCCAGG + Intronic
1142950348 17:3473245-3473267 TCCATCCTGACCAACTTTCCAGG - Intronic
1148159117 17:45439997-45440019 GCCCTGCTGCCCCAGCTTCCTGG - Intronic
1150390463 17:64787082-64787104 GCCCTGCTGCCCCAGCTTCCTGG - Intergenic
1151660908 17:75517410-75517432 GTGATGCTGCCCCACTTTCCTGG + Intronic
1153178490 18:2405990-2406012 CCCAGGCTGGCCAACCTTCCCGG - Intergenic
1156949065 18:42870729-42870751 GCCATATTGCCCAACTTTATAGG - Intronic
1160772825 19:840766-840788 GCCATGTTGCCCACCTGGCCAGG + Intergenic
1161184492 19:2907342-2907364 GGCCTGCTGCAGAACTTTCCAGG - Intronic
925133946 2:1513368-1513390 GCCCTGGTGCCCACCTTCCCTGG - Intronic
927564802 2:24102986-24103008 GGCATGCAGCCCTCCTTTCCTGG + Intronic
928842654 2:35629580-35629602 GCCATCATGCCCATCTTTTCAGG + Intergenic
930058991 2:47273001-47273023 GCCATGCTGTCCAACTGCCAGGG + Intergenic
931238213 2:60429664-60429686 GCCATGCAGCAGAACTGTCCAGG + Intergenic
940026087 2:149210024-149210046 CCCTTGCTGCCCAGCTTTCAAGG - Intronic
942678251 2:178450913-178450935 GCCCTGCCGCCCAACGCTCCCGG + Intronic
946206070 2:218109594-218109616 GCCATGTTGCCCAACTTTAGAGG + Intergenic
947809112 2:232989083-232989105 GCCCTACTCCCCAACTATCCAGG - Intronic
948138063 2:235652125-235652147 GACATGCTGATCAGCTTTCCAGG + Intronic
1168913552 20:1468583-1468605 GAAATGCACCCCAACTTTCCAGG + Intronic
1169695773 20:8385353-8385375 ACCAAGCTGCCCAGCCTTCCTGG + Intronic
1170981774 20:21220935-21220957 TGCATGCTGCCCACCTCTCCAGG - Intronic
1172182550 20:33012501-33012523 TCCAACCTTCCCAACTTTCCAGG + Intronic
1173178727 20:40785585-40785607 CACATGCTGCACAGCTTTCCTGG - Intergenic
1173459900 20:43234725-43234747 GCCATGGTGCCCACCTGGCCTGG - Intergenic
1174459663 20:50673425-50673447 GCCAGGCTGGCCACCTTTGCAGG - Intronic
1179367395 21:40771221-40771243 ACCATGCTGCCCATTTTACCAGG + Intronic
1185131273 22:49040417-49040439 GCCTTGCTCCCCAGCTCTCCTGG - Intergenic
950409584 3:12826689-12826711 GCCATCATGCCCAACCTACCTGG + Intronic
950646060 3:14377489-14377511 GCCCTTCAGCCCAGCTTTCCTGG + Intergenic
950660133 3:14461999-14462021 GCCCTGTGGCCCAACTGTCCAGG - Intronic
951828201 3:26893172-26893194 GCCATGTTGCCTAACTTTAAGGG - Intergenic
953574375 3:44101275-44101297 GCAATGATGCCCACCTTTCAGGG + Intergenic
953940118 3:47087273-47087295 GCCATGGTCCCCAACCTTTCTGG + Intronic
954308753 3:49748002-49748024 GCCATACTGCCCCACTTCCATGG + Exonic
958067887 3:88567980-88568002 GGCAGGCTGTCCAATTTTCCTGG - Intergenic
959139597 3:102470054-102470076 TCCATGCTGACCAACATTTCCGG + Intronic
960987422 3:123290029-123290051 GCCATGCTGCTGCACTTCCCTGG - Intronic
961076547 3:123987995-123988017 ACCATGTTGCACAACTTTACAGG - Intronic
961174784 3:124825706-124825728 GGCATGCTGGGAAACTTTCCGGG + Intronic
961867486 3:129964250-129964272 GCCATGCTGTCCAACCTCTCAGG - Intergenic
962036028 3:131652797-131652819 GCCATGTTGTCCAACTGTCCTGG + Intronic
963785072 3:149526222-149526244 GCCATGCTGCCCAACTTTCCAGG + Intronic
967995368 3:195162234-195162256 CCCATGCTGCCCTGCCTTCCGGG + Intronic
968397570 4:256846-256868 GCCCAGCTGCCCAACTTTCTGGG - Intergenic
968943427 4:3651309-3651331 TTCCTGCTGCCCACCTTTCCAGG + Intergenic
969342600 4:6551627-6551649 TCCATGGTGCTCAAGTTTCCTGG - Intronic
971242341 4:24900004-24900026 GAAATTCTGCCCAACCTTCCTGG + Intronic
975605342 4:76148779-76148801 GCCCTGCTGCCCGACCTCCCAGG - Intergenic
976777688 4:88723827-88723849 CTCCTGCTGCCCAACTCTCCAGG + Intergenic
984150709 4:176126730-176126752 GCCATGATCCCCAACTGTCAAGG + Intronic
986275733 5:6273729-6273751 GCCATTCAGACCAGCTTTCCTGG - Intergenic
988481368 5:31634120-31634142 CCCAAGCTTCCCAACTTTGCGGG + Intergenic
991357178 5:65780956-65780978 GCCACTGTGCCCAGCTTTCCTGG + Intronic
994155666 5:96501103-96501125 GCCATTCTGCCGAAGTTTTCAGG - Intergenic
994809732 5:104499652-104499674 CCCATCCTGCTTAACTTTCCTGG - Intergenic
997585744 5:135042026-135042048 ACCAGCCTGCCCAGCTTTCCTGG - Intronic
1004918658 6:20356034-20356056 GCCAAGCTGCCCAATCTTCTGGG - Intergenic
1010211697 6:73367311-73367333 GCCACCGTGCCCAGCTTTCCTGG - Intergenic
1011212634 6:84970457-84970479 GTGATGCTGCCTAACTTTCAAGG - Intergenic
1011374218 6:86672862-86672884 GCCATGTTGCCCAACTCTAGAGG + Intergenic
1012869791 6:104659287-104659309 GCCATGCTGACCAGCTGCCCAGG + Intergenic
1012928194 6:105289202-105289224 GCCATCGTGCCCACCTCTCCAGG + Intronic
1017613299 6:156214090-156214112 GCCATGCTGCCACAGTCTCCAGG + Intergenic
1017708975 6:157148800-157148822 GTCATGCTGCTCATATTTCCAGG - Exonic
1020002935 7:4765868-4765890 GCCCTGCTTCCCCACTTCCCAGG - Exonic
1021052297 7:16002666-16002688 GGCCTGCTGGCCAACATTCCAGG - Intergenic
1021732588 7:23610316-23610338 GCCCTGCCGCCCCACCTTCCTGG + Intronic
1022468766 7:30668896-30668918 GCCATGGCGCCCAACTCCCCAGG + Intronic
1025818905 7:64945399-64945421 GCCATGCTGCCCAGACATCCTGG - Intergenic
1026343431 7:69453641-69453663 GCCGTGCTTCCCAAATTTGCTGG - Intergenic
1026465091 7:70646928-70646950 GCCTTGCTGCTCATCATTCCAGG + Intronic
1027415922 7:77974962-77974984 GCCATGTTGCCCAGTTGTCCAGG - Intergenic
1029306057 7:99620947-99620969 GCCATGTTGCCCAGGCTTCCTGG + Intronic
1030107005 7:105995973-105995995 GCCATGCTGCACATCTATCCCGG - Intronic
1030335083 7:108317069-108317091 GCCATGCTGTGCAACTTTTCAGG - Intronic
1032553189 7:132805022-132805044 GCCATGCTGCCAAACTTCCTTGG + Intronic
1032587797 7:133163781-133163803 GTCATGATCCCCAACCTTCCTGG + Intergenic
1034217627 7:149420580-149420602 CCCATGCCGCCCAACTTCCTGGG - Intergenic
1037915296 8:22769270-22769292 ACCATGCAGCCCAAGTTTACAGG + Intronic
1042658995 8:71133303-71133325 GTTATGCTGCCCATATTTCCTGG + Intergenic
1043563620 8:81523454-81523476 GGCATGCTGCTCATCTCTCCTGG + Intergenic
1043867228 8:85389264-85389286 GCCATGTTGCCCAAACTTGCCGG - Intronic
1044016132 8:87050553-87050575 GCCAGACTGCCCAACTAACCTGG - Intronic
1044553263 8:93535416-93535438 GCCCTGTTCCCCACCTTTCCAGG + Intergenic
1048997942 8:139805579-139805601 GCCAGGCTCCCCTACTGTCCAGG + Intronic
1049709463 8:144057118-144057140 GCCATGCTGCCCATCCCTGCAGG - Exonic
1049831511 8:144704301-144704323 CCCCTGCTGACCACCTTTCCAGG + Intergenic
1051503406 9:17802467-17802489 GCCAATCTGACCAATTTTCCTGG + Intergenic
1056154991 9:83825225-83825247 TCCATGCTGCCCAAATTCACCGG - Intronic
1056355805 9:85800211-85800233 TCCATGCTGCCCAAATTCACCGG - Intergenic
1057407964 9:94790535-94790557 GCCATTCTCTCCAACTTGCCTGG - Intronic
1058282356 9:103131626-103131648 ACAATGCTCCCCAACATTCCTGG + Intergenic
1060864562 9:126985111-126985133 GCCATGCTGCCCACATTCCATGG - Intronic
1061574586 9:131497986-131498008 GCCATGCGGCTCAAGTGTCCAGG - Exonic
1062110843 9:134781344-134781366 GCCAAACTGCTCAGCTTTCCCGG - Intronic
1185539912 X:894888-894910 GCCATGGTGCCCAGCCTTACTGG - Intergenic
1186202011 X:7164496-7164518 GCTATTCTGCCCAGCTTTTCTGG - Intergenic
1190388843 X:49911794-49911816 ACCATGCTGCCCCACCTTGCCGG - Intergenic
1190556676 X:51642537-51642559 GGCAGGCTTCCCCACTTTCCAGG + Intergenic
1192312965 X:70031774-70031796 GCCATGATCCCCACCTGTCCAGG + Intronic
1193425016 X:81331731-81331753 GCCATACTGCCCAAATTTATAGG - Intergenic
1197610213 X:128629895-128629917 ACCAGGATGGCCAACTTTCCAGG - Intergenic
1199712784 X:150482789-150482811 GCCATTATGCTCAATTTTCCAGG - Intronic
1201782387 Y:17738014-17738036 TCCATGCAGCCCAAATTTCCTGG + Intergenic
1201819166 Y:18167974-18167996 TCCATGCAGCCCAAATTTCCTGG - Intergenic