ID: 963785613

View in Genome Browser
Species Human (GRCh38)
Location 3:149531550-149531572
Sequence GCGCAGGTGCAGGAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 769
Summary {0: 1, 1: 1, 2: 6, 3: 61, 4: 700}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963785613_963785620 1 Left 963785613 3:149531550-149531572 CCTCCCACCTCCTGCACCTGCGC 0: 1
1: 1
2: 6
3: 61
4: 700
Right 963785620 3:149531574-149531596 AACTGTTCTATCTGCTTGCAAGG 0: 1
1: 0
2: 0
3: 15
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963785613 Original CRISPR GCGCAGGTGCAGGAGGTGGG AGG (reversed) Intronic
900148662 1:1168910-1168932 GGGCAGCTGCAGGAGGTGGCAGG + Intergenic
900151462 1:1180933-1180955 GCGCAGGGGCAGGGGTGGGGCGG - Intronic
900191000 1:1352173-1352195 GCACAAGTTCAGGCGGTGGGAGG - Intergenic
900408233 1:2501737-2501759 GAGCAGGTGCAGGCTGTGGTGGG + Intronic
900988854 1:6088771-6088793 GGGCAGCAGCAGGGGGTGGGGGG - Intronic
901135204 1:6988596-6988618 GCGCAGGGGTAGGGGGTGGGGGG - Intronic
901633590 1:10659435-10659457 GCGCAGGTCCAGGAGCGGGGGGG + Intronic
901685022 1:10938974-10938996 GCGCAGGGACAGAGGGTGGGAGG + Intergenic
901771950 1:11535080-11535102 CAGCAGGAGCAGGATGTGGGTGG - Exonic
902828746 1:18995833-18995855 GGGCAGGGGCAGGGGGTGAGGGG + Intergenic
903055470 1:20633435-20633457 GCGCAGGCGCAGGCGCTGGTGGG - Exonic
903267568 1:22167115-22167137 GAGCACCTGCAGGAGGTGGTTGG + Intergenic
903907591 1:26697157-26697179 GCGGAGGCGCTGGAGGAGGGAGG - Exonic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904614597 1:31743046-31743068 GGGCAGGCGCCGGTGGTGGGCGG - Intronic
904648494 1:31986718-31986740 GAGTGGGTGCAGGAGGTGGAGGG - Intergenic
905010661 1:34744976-34744998 GCCCAGCAGCTGGAGGTGGGTGG + Intronic
905077546 1:35286705-35286727 GCTCAGGTGGGTGAGGTGGGAGG - Intronic
905401779 1:37708843-37708865 GGGTAGGTCCAGAAGGTGGGGGG + Exonic
906006079 1:42471668-42471690 GACCAGGTGAAGGAGGTCGGGGG + Intronic
906035674 1:42748971-42748993 GGGAAGGTGCAGGAGGTGGATGG - Intronic
906057090 1:42925707-42925729 GGAGGGGTGCAGGAGGTGGGTGG + Exonic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906223457 1:44101943-44101965 GCTCAGGTGGCTGAGGTGGGAGG + Intergenic
906676977 1:47700376-47700398 GTGCAGGAGCAGCAGGTGGGTGG + Intergenic
906943419 1:50275634-50275656 GCGGAGGTGGTGGTGGTGGGTGG - Intergenic
907440374 1:54474937-54474959 GCGCAGGGGGAGCAGGTGGCGGG + Intergenic
907521939 1:55029597-55029619 GTGCAGGAGCAGGGGGTTGGGGG - Intergenic
909374571 1:74924616-74924638 GTGCACCTGCAGGAGGTGGCTGG - Intergenic
911521672 1:98937145-98937167 GCCCAGGTGCAGGCAGTGAGGGG + Intronic
911729322 1:101276554-101276576 GAGAAGGTGGAGGAGGTGGAAGG - Intergenic
912372371 1:109183946-109183968 GGGCTGGTGCGGGAGGCGGGAGG + Intronic
912948610 1:114105341-114105363 GCGCAGGCTCTGGAGGTAGGGGG - Intronic
913231161 1:116741847-116741869 GCGCAGGTGCAGGCCGCGGAGGG - Intergenic
913439165 1:118879008-118879030 GTGGAGGTGCTGGGGGTGGGTGG + Intergenic
914889832 1:151612547-151612569 GTGCAGGGGCAGGAGGGGCGCGG - Intronic
915899044 1:159833379-159833401 CTGCAGGTGCAGGAGGTAGGTGG + Intronic
916694640 1:167222031-167222053 GGTCAGGCGCAGGGGGTGGGGGG - Intronic
917117603 1:171618177-171618199 GCACAGGTGCAGGTGCTGAGTGG + Intergenic
917415435 1:174804377-174804399 GCTCAGGAGGATGAGGTGGGAGG - Intronic
917975389 1:180234657-180234679 ACGCAGGTGCAGCAGGTGAGGGG + Intronic
918041607 1:180917113-180917135 GTGTAGGTCCAGGTGGTGGGGGG + Intronic
918480653 1:184974067-184974089 AGGCAGGTGCAGGATGCGGGTGG - Intronic
919991916 1:202713334-202713356 GGGTATGTGCAGGGGGTGGGAGG - Intergenic
920085310 1:203411333-203411355 TGGGAGGTGCAGGAGGTGAGTGG - Intergenic
920097183 1:203493937-203493959 GAGCAGGAGCTGGAGGTGGGGGG + Intergenic
920296667 1:204961608-204961630 GCTAAGCTGCAGGAGGTTGGTGG - Intronic
920510167 1:206545011-206545033 GGGCAGGTGCTGGGGGTGGGGGG + Intronic
921060252 1:211578964-211578986 GAGCAGGAGCAGGAGGGCGGCGG + Intergenic
921580506 1:216890920-216890942 TCGAAGGTTCAGGAGTTGGGTGG - Intronic
922603149 1:226871851-226871873 GCGCAGGTGCAGAAGGGGCCTGG + Intronic
922665602 1:227466007-227466029 GAGCTGGTGCAGGAGGTCAGTGG + Intergenic
922665673 1:227466478-227466500 GAGCTGGTGCAGGAGGTCAGTGG + Intergenic
922712826 1:227845888-227845910 GGACAGGTGCAGGAGGCGGCAGG + Intronic
923087016 1:230709804-230709826 CAGCAGGTCCAGGAGGTGGACGG + Intronic
923687565 1:236163946-236163968 GGGGAGGTGTGGGAGGTGGGAGG - Intronic
923832269 1:237571016-237571038 GCTCAGGTGGCTGAGGTGGGAGG + Intronic
923887295 1:238173245-238173267 TGGCTGGAGCAGGAGGTGGGAGG - Intergenic
924560343 1:245153582-245153604 GCGCAGGAGCTGGAGCGGGGAGG + Intergenic
1062810509 10:459928-459950 GCTCACGTGCAGCAGGTGGTTGG - Intronic
1062843783 10:689681-689703 GCGCGGGCGCGGGAGGCGGGCGG + Intronic
1062920516 10:1275330-1275352 CCCCAGCTGGAGGAGGTGGGAGG + Intronic
1062982524 10:1737179-1737201 GTGCAGGTGCAGGAGGGAGGCGG - Exonic
1063383088 10:5598796-5598818 CAGGAGGTGAAGGAGGTGGGGGG - Intergenic
1063515768 10:6693626-6693648 TGGCAGGCGCAGGAGGAGGGGGG - Intergenic
1064837803 10:19554325-19554347 GAGCAGGAGCAAGAGGTGGAGGG + Intronic
1065099793 10:22321484-22321506 GCGCCGGAGCAGGAGGAGGCCGG + Exonic
1065281789 10:24146572-24146594 GCTCAGGAGATGGAGGTGGGAGG + Intronic
1066026511 10:31363917-31363939 GCACAGGTGCAGGAGCTGCAGGG + Intronic
1066129750 10:32381354-32381376 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
1066518693 10:36192548-36192570 GTGCAGGGGGAGGGGGTGGGTGG - Intergenic
1067045187 10:42981442-42981464 GCGCAGCTTCTGGAGCTGGGAGG + Intergenic
1067338516 10:45382778-45382800 GTGCAGGGGCGGGAAGTGGGAGG + Intronic
1067382440 10:45787406-45787428 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1067890138 10:50127954-50127976 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1068138529 10:52975174-52975196 GCTCAGGAGCCTGAGGTGGGAGG - Intergenic
1068742533 10:60490398-60490420 GAGGAGGTGCAGGAGGTTTGAGG - Intronic
1069546055 10:69329791-69329813 GGGGAGGGGCAGGAGATGGGGGG - Intronic
1069633839 10:69913609-69913631 GCCCATGTGCAGGAGGCAGGAGG - Intronic
1069651578 10:70053371-70053393 GCGCAGGAGCGGGAGGACGGAGG + Intronic
1069942332 10:71964301-71964323 GCGCAGGGGTGGGAGCTGGGTGG + Intergenic
1070668811 10:78363753-78363775 GAGCAGGTGGAGGTGATGGGTGG + Intergenic
1071575535 10:86723159-86723181 GCTCAGGAGCCTGAGGTGGGAGG + Intronic
1071960434 10:90804503-90804525 GAGCAGGTGCAGGAGCTGGGGGG - Intronic
1072136012 10:92547180-92547202 GCGCAGGAGGCTGAGGTGGGAGG - Intronic
1073125118 10:101144594-101144616 GGGCAGGTGCAGAAGGAGAGGGG - Intergenic
1073340929 10:102744035-102744057 GAGCAGGAGCAGGAGGGGGATGG + Exonic
1074532059 10:114304979-114305001 ACGCAGATGCAGGAGGGGGCGGG + Intronic
1074532230 10:114305573-114305595 GCGCAGATGCAGGAGGCGACGGG + Intronic
1074779598 10:116791751-116791773 TGGCAGGGGCTGGAGGTGGGAGG - Intergenic
1075045816 10:119145929-119145951 GCGCAGGAGACTGAGGTGGGAGG - Intronic
1075724978 10:124606470-124606492 GGGCAGATGGTGGAGGTGGGAGG + Intronic
1076354198 10:129840265-129840287 GCGCTGGTGCAGGAAGGAGGAGG + Exonic
1076615216 10:131750410-131750432 GCCCAGGTGCAGGCCGTGGGAGG - Intergenic
1076734523 10:132452756-132452778 CCCCAGGGGCAGGAGGTGAGGGG - Intergenic
1076802288 10:132836141-132836163 GGAAAGGTGCAGGCGGTGGGAGG - Exonic
1076900594 10:133335736-133335758 GCGCAGGTGCAGGGAGGGGCCGG - Intronic
1077015989 11:399403-399425 GGGCAGGTGGAGGAGGGGGCAGG - Intronic
1077020202 11:413919-413941 GAGAAGGTGCAGGAGGAGGCAGG - Intronic
1077081568 11:726775-726797 GCGCAGGGGCAGGAGGGGCGTGG - Intronic
1077131209 11:973674-973696 GCGCTGGTGCAGGAGAGGGAGGG + Intronic
1077139756 11:1019061-1019083 GCAGAGGTGCAGGAGGGTGGGGG - Intronic
1077204031 11:1332930-1332952 GAGCAGGAGCAAGAGGGGGGAGG + Intergenic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077319719 11:1935778-1935800 ACCCAGGTGCAGCAGGTGTGGGG + Intronic
1077382581 11:2251211-2251233 CAGCAGGTGCTGGAGGTGGGGGG - Intergenic
1077408705 11:2393723-2393745 GAGCGGGTGAAGGCGGTGGGTGG + Intronic
1077408714 11:2393750-2393772 TGGCAGGTGCAGGCGGTGGGTGG + Intronic
1078094258 11:8286961-8286983 GGGCAGGTGGAGGAGGGAGGAGG - Intergenic
1078463861 11:11535791-11535813 GGGCAGATGCAGGAGGAAGGTGG - Intronic
1078729472 11:13962648-13962670 GCGAAGGAGCGGGAGGAGGGAGG - Intergenic
1079406988 11:20156343-20156365 CCGCAGGTGCTGGGGGTCGGAGG + Exonic
1080578614 11:33623120-33623142 GGGCAGGTGTGGGAAGTGGGTGG - Intronic
1081625905 11:44654938-44654960 GCCTGGGTGCAGGTGGTGGGTGG - Intergenic
1081867603 11:46368065-46368087 GAGCAGCTGGAGAAGGTGGGTGG + Exonic
1081911151 11:46700713-46700735 GGGCATGTGCAGGAAGTGGGCGG - Intergenic
1082784071 11:57307285-57307307 GCGCAGGACTAGGAGTTGGGAGG - Intronic
1082936118 11:58658628-58658650 CTGCAGGTGCAGGAGGAGAGAGG + Intronic
1083824342 11:65189963-65189985 GCACAGGTGCAGAAGGCTGGGGG - Intronic
1084219470 11:67668286-67668308 GCACAGGTGCAGGTGGGGGTAGG + Intronic
1084296391 11:68215293-68215315 GGGCAGGTGAAGGCAGTGGGAGG - Intergenic
1084519473 11:69654762-69654784 GCACAGGTGTGTGAGGTGGGAGG + Intronic
1084564390 11:69920941-69920963 CCACAGGTGCAGGAGGGTGGGGG + Intergenic
1085022658 11:73218918-73218940 GGGCAGTTGCAGGGAGTGGGCGG + Intronic
1085122078 11:73973693-73973715 GGGCAGGGGCAGGTGGAGGGGGG + Intergenic
1085390675 11:76180555-76180577 GTGTATGTGCAGGAGGTGGTGGG + Intergenic
1085615458 11:77994714-77994736 GCGTAGGCGCGGGGGGTGGGTGG + Intergenic
1085917179 11:80903604-80903626 GGGGAGGAACAGGAGGTGGGTGG - Intergenic
1086942558 11:92813562-92813584 AAGCAGGTGCAGGGAGTGGGTGG - Intronic
1087093981 11:94303021-94303043 GCGCATATGCAGGTGGAGGGAGG - Intergenic
1087779989 11:102291634-102291656 GGGGGAGTGCAGGAGGTGGGTGG - Intergenic
1088065232 11:105709684-105709706 ACCCAGGAGGAGGAGGTGGGAGG + Intronic
1088588321 11:111379343-111379365 GCACCGGTGCCTGAGGTGGGAGG - Exonic
1088822329 11:113467043-113467065 GTGCGGGGGCAGGCGGTGGGAGG + Intronic
1089640433 11:119844246-119844268 GGGCAGGGGCAGGGGGTGGAGGG - Intergenic
1089839262 11:121400161-121400183 AGGCAGGGGCAAGAGGTGGGAGG + Intergenic
1090255185 11:125278934-125278956 GTGGAGGTGCAGGAGGCTGGCGG + Intronic
1091159687 11:133408696-133408718 GCACAGCTGTAGGATGTGGGAGG + Intronic
1091207957 11:133833696-133833718 GGGCAGGGGCAGGCGGAGGGCGG - Intergenic
1091313077 11:134588493-134588515 TCGCAGGTGCAGCACGTGGCAGG - Intergenic
1091313101 11:134588665-134588687 TCGCAGGTGCAGCACGTGGCAGG - Intergenic
1091446761 12:548191-548213 GGGTAGATGCAGAAGGTGGGAGG - Intronic
1091546318 12:1503515-1503537 GGGCAGGTGCCTGAGGTGGCAGG - Intergenic
1091668055 12:2433355-2433377 GCCCAGGTGCAGGAGAGAGGAGG + Intronic
1091704916 12:2687213-2687235 GGGCAGGGGCAGGAGGTGGAAGG + Intronic
1091778468 12:3199686-3199708 GCGCAGCTGCAGGAGCCTGGCGG + Intronic
1091779270 12:3203827-3203849 GAGCAGGTGCAGGAGGGTGTTGG + Intronic
1092526716 12:9314156-9314178 GCACTGGTGCAGGGGCTGGGTGG + Intergenic
1092540557 12:9417623-9417645 GCACTGGTGCAGGGGCTGGGTGG - Intergenic
1094057900 12:26285291-26285313 TGGCAGATGCTGGAGGTGGGAGG + Intronic
1094199142 12:27779869-27779891 GCGCAGCTGCGGGAGGCGGAGGG - Intergenic
1094512490 12:31104859-31104881 GCACTGGTGCAGGGGCTGGGTGG + Intergenic
1094842947 12:34349569-34349591 GCGCATGTGCAGCAGGGGGAGGG + Intergenic
1096024767 12:48350977-48350999 GCGGAGGTGCGGGGAGTGGGAGG + Intronic
1096072351 12:48782412-48782434 GAGGAGGAGCAGGAGGTGGGAGG - Intronic
1096255347 12:50058779-50058801 GCCGAGGAGGAGGAGGTGGGTGG + Exonic
1096482423 12:51951610-51951632 GCGCACGTGCAGGCGCCGGGCGG + Intergenic
1096846537 12:54410231-54410253 GAGCAGGGGCAGGAGGATGGTGG + Intronic
1096849863 12:54428615-54428637 GGGCAGTAGCTGGAGGTGGGAGG - Intergenic
1096975263 12:55696239-55696261 GCCCAGGGGGAGGAGCTGGGAGG - Intronic
1097093694 12:56528138-56528160 GCTCAGGAGCCTGAGGTGGGAGG + Intronic
1097760595 12:63459780-63459802 GCTCTGGTGGAGGTGGTGGGGGG - Intergenic
1099138820 12:78943405-78943427 GAGCAGGAGCAAGAGGTGAGGGG + Intronic
1100186360 12:92144919-92144941 GGGCAGGGGCAGGAGGCGCGGGG + Intronic
1100203574 12:92325277-92325299 GGGGAGGAGCAGGTGGTGGGTGG + Intergenic
1100287165 12:93177925-93177947 GCTCAGGCACAGAAGGTGGGGGG + Intergenic
1101445148 12:104732136-104732158 GCTCAGAAGCAGGAGGTGGCAGG + Intronic
1101455295 12:104825255-104825277 GCCCAGGTGCCTGAGCTGGGAGG - Intronic
1102361993 12:112296138-112296160 GTGTAGGTGCAGCAGGTGGTAGG + Intronic
1102441381 12:112966401-112966423 CAGCAGGTGGAGGAGGTGGGTGG - Intronic
1102496470 12:113322839-113322861 ACTCAGGAGGAGGAGGTGGGAGG + Intronic
1102703421 12:114860306-114860328 GCCCAGGGGCTGGAGGTGAGAGG - Intergenic
1102979869 12:117232974-117232996 ACTCAGGAGCATGAGGTGGGAGG - Intronic
1103414808 12:120736980-120737002 GCCCAGGTGAAGAAGATGGGCGG + Exonic
1103524763 12:121560461-121560483 AGGCTGATGCAGGAGGTGGGTGG + Intronic
1103763279 12:123266149-123266171 GCGGTGGTGGAGGAGGGGGGAGG - Intronic
1103821333 12:123701233-123701255 CCGGAGGTGGAGGAGTTGGGAGG + Intronic
1103851846 12:123938517-123938539 GAGCAGGAGAAGGAGGTGGCTGG - Intronic
1103902796 12:124311949-124311971 GCGCGGGAGGAGGGGGTGGGGGG + Intronic
1103907532 12:124335234-124335256 CCGCAGGTGTGGGAGGTGGGCGG + Exonic
1104009459 12:124919177-124919199 GCTCAGGAGGATGAGGTGGGAGG + Intergenic
1104362220 12:128144597-128144619 GGGCAGGAGCAGGGGCTGGGAGG - Intergenic
1104638369 12:130451683-130451705 TCGCAGGTGCAGGAGGTTTGCGG - Intronic
1104781278 12:131422098-131422120 GGACAGGTGGAGGAGGAGGGAGG - Intergenic
1104942877 12:132403138-132403160 GCGGAGGGGCAGGTGGTGGGAGG + Intergenic
1104960199 12:132484927-132484949 GGGCAGTGGCAGGAGGTGGCTGG + Intergenic
1105728143 13:23186086-23186108 GGGTAGGTGAAGGCGGTGGGAGG - Intronic
1106102641 13:26708043-26708065 GGGCAGGGGAATGAGGTGGGTGG - Intergenic
1106833489 13:33610506-33610528 GCGCAGGCGCAGGAGCAGCGCGG - Intergenic
1108781129 13:53835525-53835547 GCAGAGGTGGAGGAGGTGGAAGG - Intergenic
1112081091 13:95971470-95971492 GACCAGGTGTAGGAGCTGGGGGG + Intronic
1112228936 13:97568623-97568645 GCACAGGAGAAGGAGGTGGCTGG - Intergenic
1112290641 13:98142509-98142531 GCGCTGGGCCAGGACGTGGGCGG + Intergenic
1112399985 13:99068048-99068070 ATGCTGGGGCAGGAGGTGGGGGG - Intronic
1113448380 13:110387798-110387820 GAGCAGCTGCAGCAGCTGGGCGG - Intronic
1113540113 13:111100637-111100659 CCACAGCTGCAGGACGTGGGAGG + Intergenic
1113660863 13:112105576-112105598 GCGCGGGTGCGGGAGGCGGAGGG + Intergenic
1114529124 14:23384530-23384552 GCGCGGGTGCGGGAGCTGGAGGG - Exonic
1114555012 14:23556815-23556837 GAGCGGCTGCAGGAGTTGGGGGG + Exonic
1115013232 14:28576739-28576761 ACTCAGGAGCCGGAGGTGGGAGG - Intergenic
1115072617 14:29343170-29343192 ACTCAGGAGTAGGAGGTGGGAGG - Intergenic
1115479588 14:33848506-33848528 GCACAGGTTCTGGAGGTGGGGGG - Intergenic
1115575738 14:34708894-34708916 GCTCAGGAGCTTGAGGTGGGAGG + Exonic
1115815590 14:37160996-37161018 GGGCAGGTGGAGGGGGCGGGGGG + Intronic
1116996339 14:51328985-51329007 TTGCAGGTGCTGGAGGTGGGCGG + Intergenic
1117602675 14:57390990-57391012 CCGGAGGTGCTGGTGGTGGGAGG - Exonic
1118834650 14:69468687-69468709 GCTCAGGAGGATGAGGTGGGAGG - Intergenic
1118849328 14:69572412-69572434 GCGCAGGTGGAGGAGCGGCGAGG - Exonic
1120780083 14:88479234-88479256 GCGCACGTGCAGGAGGCGCCCGG + Exonic
1121048131 14:90802747-90802769 GCGCAGGTGCAGGCGTGGAGAGG + Intronic
1121106766 14:91285350-91285372 TCGCAGGTGCAAGAGACGGGAGG + Intronic
1121141115 14:91543385-91543407 CCACAGGTTAAGGAGGTGGGAGG - Intergenic
1121278040 14:92680961-92680983 TCACAGGGGCAGGGGGTGGGGGG - Intronic
1121559935 14:94866916-94866938 GGGCAGGTGCAGGAGGAAGAGGG + Intergenic
1121826871 14:97017360-97017382 GAGCAGGAGAATGAGGTGGGAGG - Intergenic
1122007277 14:98715992-98716014 GGGGAGGTGCAGCAGGTGAGGGG + Intronic
1122136288 14:99634936-99634958 GCGTGGGTGAAGGAGATGGGGGG - Intergenic
1122220934 14:100238905-100238927 GCGGAGGCGCAGGAGGAAGGGGG + Intronic
1122292755 14:100688366-100688388 GCGGAGCTTCAGGAGGAGGGAGG - Intergenic
1122788328 14:104174034-104174056 GGGCTGGTGCCGGAGCTGGGTGG + Intronic
1122879205 14:104682472-104682494 GGGCAGGGCCAGGAGGCGGGAGG + Intergenic
1122912314 14:104836852-104836874 ACGCCGGTGCAGGGGGGGGGGGG - Intergenic
1122917440 14:104865551-104865573 GTGCAGGTGCGGGCGATGGGAGG - Intronic
1202899767 14_GL000194v1_random:28348-28370 GCGCAGGCGCCGGGGGGGGGGGG - Intergenic
1202899782 14_GL000194v1_random:28382-28404 GCGCAGGCGCGGGGGGCGGGGGG - Intergenic
1202899798 14_GL000194v1_random:28418-28440 GCGCAGGCGCAGGGGGGTGGGGG - Intergenic
1123468253 15:20531601-20531623 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1123649863 15:22469463-22469485 GCACAGGTGAAGGATGTGGAGGG - Intergenic
1123728570 15:23126811-23126833 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1123740264 15:23278282-23278304 GCACAGGTGAAGGATGTGGAGGG - Intergenic
1123746734 15:23324276-23324298 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1124051215 15:26198938-26198960 GCGCATGTGAAGGAAGTGGTGGG - Intergenic
1124279001 15:28347592-28347614 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1124957873 15:34371260-34371282 GAGGAGGAGAAGGAGGTGGGGGG - Intergenic
1125503409 15:40253032-40253054 GCTCAGGTGCAAGAGGCGGCAGG - Intronic
1126034770 15:44536490-44536512 GCGCAGATGCAGGAGCGGGTGGG - Intergenic
1126351982 15:47753351-47753373 GAGAAGGTGCAGAAGGTGAGTGG + Intronic
1126669639 15:51104477-51104499 GCGCAGATGCAGGACATGGCTGG - Intronic
1126687197 15:51258667-51258689 GCGCAGGGGTTGGAGATGGGAGG - Intronic
1128577648 15:68787365-68787387 CTGCAGGGGTAGGAGGTGGGAGG - Intronic
1128740557 15:70080846-70080868 GCCCAGGAGCAGGAGGTTGCTGG - Intronic
1129386772 15:75200814-75200836 GAGCGGGGGCGGGAGGTGGGGGG - Intronic
1129667975 15:77590144-77590166 GCACAGGGGCAGGAGGGGTGAGG + Intergenic
1130726287 15:86442920-86442942 GGGCAGGAGCAGGGGGTGGGAGG - Intronic
1130953464 15:88610618-88610640 GCTCAGGAGCAGGAGGAGTGGGG - Intergenic
1131118201 15:89806997-89807019 TCCCAGGGGCAAGAGGTGGGAGG + Intronic
1131222792 15:90598930-90598952 GAGCAGGTGGAGGGGGTGGCGGG - Intronic
1132010287 15:98268953-98268975 GAGCAGCGGCTGGAGGTGGGTGG + Intergenic
1132342330 15:101086441-101086463 GCGCAGGCGCCGGAGGAGGCCGG - Intergenic
1132538878 16:498280-498302 CCTCAGGAGGAGGAGGTGGGAGG - Intronic
1132601312 16:774406-774428 GCGCAGGTGCAGGAGGTAGGAGG - Exonic
1132699474 16:1216186-1216208 GCGCAGGGACAGGAAATGGGTGG - Intronic
1132709229 16:1259075-1259097 GGGCAGCTGCAGGAGCTGCGGGG + Intergenic
1132892445 16:2210913-2210935 GCGCAGGGTCAGGAGGGGAGGGG - Exonic
1132981358 16:2740069-2740091 GGGCAGCTGCAGGGGGTGAGGGG - Intergenic
1133005648 16:2880213-2880235 GGGCAGGTTCTGGGGGTGGGTGG - Intergenic
1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG + Intronic
1135867137 16:26114141-26114163 GCTCAGATGCAGGTGGTGTGGGG + Intronic
1136153747 16:28368470-28368492 GCGCAGGTGCTGGAGGGAGCTGG - Intergenic
1136183824 16:28573256-28573278 GAGGAGGAGCTGGAGGTGGGTGG + Intronic
1136209345 16:28746800-28746822 GCGCAGGTGCTGGAGGGAGCTGG + Intergenic
1136252126 16:29012293-29012315 GAGCAAGTGGGGGAGGTGGGTGG - Intergenic
1136547921 16:30965819-30965841 GGGGTGGTGGAGGAGGTGGGGGG - Exonic
1136621009 16:31428245-31428267 ACGGAGGAGCAGGAGGTGAGTGG - Exonic
1137238307 16:46633532-46633554 GAGCAGGTGCAGGAGAGGAGAGG + Intergenic
1138354521 16:56366816-56366838 GGGCACGGGCAGGGGGTGGGGGG + Intronic
1138829525 16:60359570-60359592 GCACAGGTGCAGGAGCCGCGGGG + Exonic
1139964305 16:70737063-70737085 GCTCAGGAGGAGGAGATGGGTGG + Intronic
1141054441 16:80803510-80803532 GTGCGGGGGCAGCAGGTGGGGGG + Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141235434 16:82211520-82211542 GAGCAGGAGAAAGAGGTGGGGGG + Intergenic
1141266891 16:82505826-82505848 TGGCAGGTACAGGAGCTGGGTGG + Intergenic
1141466719 16:84210887-84210909 GTACAGGTGGATGAGGTGGGGGG + Intergenic
1141503657 16:84461288-84461310 GCCCATGTGCAGGAAGCGGGAGG + Intronic
1141579671 16:84988598-84988620 CCGCAGGAGCAGGAGCGGGGTGG + Intronic
1141648021 16:85377824-85377846 CCACATGTGCAGGAGCTGGGGGG + Intergenic
1141779646 16:86150992-86151014 GCCCAGGTGGAGGAGGCTGGGGG + Intergenic
1142014868 16:87740096-87740118 GAGAAGGTGCAGGGGGTTGGGGG - Intronic
1142221409 16:88856767-88856789 GAGCAGGAGCAGGATGTTGGGGG + Exonic
1142239177 16:88937405-88937427 TCGCAGGGGCAGGAGAGGGGTGG - Intronic
1142403785 16:89874387-89874409 GCGTAGGGGCAGGAGTCGGGTGG + Intronic
1142423419 16:89987411-89987433 GAGGAGGTGGAGGAGGTGGTGGG + Intergenic
1142597127 17:1035352-1035374 GAGCAGGTGTAGGGGGTGGAAGG - Intronic
1142605006 17:1076703-1076725 GGGCAGGTGCACGGGGGGGGTGG + Intronic
1142764173 17:2056461-2056483 GAGAAGGAGCAGGAGGTGAGCGG - Intronic
1143096543 17:4481297-4481319 GAGCAGGGGCAGGAAGTGTGTGG + Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143356388 17:6332031-6332053 TAGCAGGTGGAGGTGGTGGGAGG - Intergenic
1143554628 17:7652374-7652396 GCACAGGTGCAGGTGAGGGGTGG + Intronic
1143738303 17:8930871-8930893 GGGCAGGTGCAGGAGGGAAGTGG + Intronic
1144519046 17:15942309-15942331 AAGCAGGAGCAAGAGGTGGGGGG - Intergenic
1144657681 17:17047943-17047965 GAGCAGGTGCAGAGGCTGGGAGG + Intronic
1145063194 17:19744993-19745015 GAGCAGGAGCAGGAGCTGGTGGG - Exonic
1145210445 17:21009150-21009172 GTGCAGAGGCAGGAGGTAGGAGG + Intronic
1145921831 17:28615536-28615558 GGGCAGGTGCATGAAGTGAGTGG - Intronic
1145964260 17:28905846-28905868 GGGAGGGAGCAGGAGGTGGGTGG + Exonic
1146886565 17:36474765-36474787 GCCCAGGTGCCGTAGCTGGGAGG + Intergenic
1146936628 17:36816278-36816300 GCGCCAACGCAGGAGGTGGGAGG - Intergenic
1147210624 17:38870662-38870684 GCGCTGGTGGAGGGGGCGGGGGG + Intronic
1147253074 17:39165278-39165300 GGGCAGGTGTCGGAGCTGGGTGG - Intronic
1147592723 17:41695219-41695241 GTACAGGTGCAGCTGGTGGGAGG - Intergenic
1147915530 17:43883158-43883180 GTGAGGGAGCAGGAGGTGGGTGG - Intronic
1147995822 17:44359878-44359900 GTGCAGGGGCAGGTGGAGGGGGG - Intronic
1148053392 17:44779970-44779992 GCTGAGCCGCAGGAGGTGGGTGG - Exonic
1148332882 17:46822456-46822478 GCGCAGGTGCACGCGGAGGTCGG + Intronic
1148683169 17:49486211-49486233 GCGCAGGTACAGGAAGTGGTGGG + Intergenic
1149984963 17:61340322-61340344 ACACAGATGCAGGGGGTGGGTGG + Intronic
1150285156 17:63950113-63950135 GCCCAGCAGGAGGAGGTGGGAGG - Intronic
1150302676 17:64059514-64059536 GAGCCGGTGGAGGAGGTGGAAGG - Intronic
1150439402 17:65179166-65179188 GTGCAGGGGAAGGAGGAGGGTGG + Intronic
1150484026 17:65531881-65531903 GAGCAGGGGTGGGAGGTGGGGGG - Intronic
1150488326 17:65559272-65559294 GCGCAGAGGGAGGGGGTGGGTGG - Intronic
1151293531 17:73166788-73166810 GTGAAGGTGGTGGAGGTGGGAGG - Intronic
1151382895 17:73737748-73737770 GCACAGGTGCAGGAGAGAGGGGG - Intergenic
1151533938 17:74726635-74726657 GGAGAGGTTCAGGAGGTGGGTGG + Intronic
1151625436 17:75272700-75272722 GCGCCCGTGCAGGAAGTGGATGG - Intergenic
1151684086 17:75636684-75636706 GCGCAGGTGGGGGAGCTGAGGGG - Exonic
1151730732 17:75909688-75909710 CCGCAGGTGCTGGAGGGGAGAGG + Exonic
1151876533 17:76870329-76870351 GAGCTGGTGCAGGCCGTGGGTGG + Intronic
1151890702 17:76949120-76949142 GCCCAGGAGCAGGTGGTCGGAGG + Exonic
1151927473 17:77209483-77209505 GCCCAGGTGCAGGAAGGCGGAGG - Intronic
1152204975 17:78969816-78969838 ACGCAGGATCTGGAGGTGGGGGG + Intergenic
1152238204 17:79149320-79149342 GCCCAGATGCAGGCAGTGGGGGG + Intronic
1152437772 17:80286669-80286691 ATGTGGGTGCAGGAGGTGGGGGG + Intronic
1152615813 17:81337288-81337310 GCCCAGGTGCAGGAGCACGGGGG - Intergenic
1152774407 17:82191532-82191554 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
1152930647 17:83107906-83107928 GGGCCAGCGCAGGAGGTGGGGGG + Intergenic
1152930671 17:83107977-83107999 GGGCAAGTGCAGGAGGTGGGGGG + Intergenic
1152930693 17:83108048-83108070 GGGCAAGCGCAGGAGGTGGGGGG + Intergenic
1153314743 18:3710824-3710846 GCACGGGTGTAGGGGGTGGGTGG + Intronic
1153568994 18:6449425-6449447 GAGCAGAGGCAGGAAGTGGGTGG - Intergenic
1156245092 18:35290261-35290283 GCGCAGGCGCAGGGCGGGGGTGG - Intergenic
1156882751 18:42100458-42100480 GAGGAGGTGCAGGGGATGGGTGG + Intergenic
1157442038 18:47718919-47718941 GGGATGGTGTAGGAGGTGGGTGG - Intergenic
1157762697 18:50275901-50275923 GGGCAGCTGCAGGAGGCAGGTGG + Exonic
1157810779 18:50694275-50694297 GCCCACGTGCATGAGGAGGGAGG - Intronic
1158519710 18:58161707-58161729 GGGGAGGGTCAGGAGGTGGGGGG + Intronic
1158635365 18:59151577-59151599 CAGCAGGTGCAGAAGGTGGCAGG - Intronic
1158976673 18:62716375-62716397 GCCCAGCTGCAGCAGGCGGGCGG - Exonic
1160037968 18:75318987-75319009 CAGCAGCTGCAAGAGGTGGGAGG - Intergenic
1160042796 18:75360818-75360840 GAGCAGGTGGAGGAGCTGAGAGG + Intergenic
1160208648 18:76858640-76858662 GTGCAGGTGGAGGAGGAAGGGGG + Intronic
1160208662 18:76858684-76858706 GTGCAGGTGGAGGAGGAAGGGGG + Intronic
1160208675 18:76858728-76858750 GTGCAGGTGGAGGAGGAAGGGGG + Intronic
1160208702 18:76858816-76858838 GTGCAGGTGGAGGAGGAAGGGGG + Intronic
1160208716 18:76858860-76858882 GTGCAGGTGGAGGAGGAAGGGGG + Intronic
1160208744 18:76858948-76858970 GTGCAGGTGGAGGAGGAAGGGGG + Intronic
1160208772 18:76859036-76859058 GTGCAGGTGGAGGAGGAAGGGGG + Intronic
1160208786 18:76859080-76859102 GTGCAGGTGGAGGAGGAAGGGGG + Intronic
1160208800 18:76859124-76859146 GTGCAGGTGGAGGAGGAAGGGGG + Intronic
1160208815 18:76859168-76859190 GTGCAGGTGGAGGAGGAAGGGGG + Intronic
1160208842 18:76859256-76859278 GTGCAGGTGGAGGAGGAAGGGGG + Intronic
1160406145 18:78647453-78647475 CCGCAGGAGCAGGAGGCGGAGGG + Intergenic
1160534587 18:79585407-79585429 GGGGAGGTGCAGGGGGTGTGGGG - Intergenic
1160541582 18:79626929-79626951 GTGCAGATTCTGGAGGTGGGTGG - Intergenic
1160551438 18:79696122-79696144 GGGCGGCTGCAGGAGGAGGGTGG + Intronic
1160558167 18:79739575-79739597 TCCCAGCTGCAGGAGGTGGTTGG + Intronic
1160735786 19:661848-661870 GAGCAGCCGCAGGAGGTGGAGGG - Intronic
1160740081 19:681555-681577 GCGCAGGTGCAGACGCAGGGCGG + Exonic
1160765601 19:806215-806237 GCGCTGGTGCAGGAGCCGGCGGG + Intronic
1160777060 19:861316-861338 GTGAGGGTGCAGGGGGTGGGGGG - Intronic
1160845623 19:1164806-1164828 GAGGAGGAGCAGGAGGAGGGAGG + Intronic
1161002964 19:1920430-1920452 GCGCAGGTGCAGGAGGGGAGAGG - Intronic
1161196600 19:2989877-2989899 TCCCAGGTTCAGGAGGTGGCAGG - Intronic
1161353380 19:3805925-3805947 CCGCAGGTGGGGGAGGTAGGCGG + Exonic
1161578184 19:5066323-5066345 GCACAGGGGCAGTGGGTGGGTGG - Intronic
1161743734 19:6042074-6042096 GCCCAGGTGCAGTACGTGGAAGG - Exonic
1161764612 19:6199785-6199807 GCGCAGGCGTAGGAGGCGGGGGG - Intergenic
1161847151 19:6718550-6718572 GGGCATGTGAAGGAGGTGCGAGG + Intronic
1161849741 19:6732158-6732180 GCGCAGGCGGCGGGGGTGGGTGG + Intronic
1162315909 19:9937705-9937727 GCAGAGGTGGAGGAGGGGGGCGG + Intergenic
1162451323 19:10756914-10756936 GGGCAGGAGCAGGAGGCAGGTGG - Intronic
1162495088 19:11019058-11019080 ACGGAGGTGCAGGCGGTGGTGGG + Intronic
1162871723 19:13591451-13591473 GCTCAGGTGACCGAGGTGGGAGG + Intronic
1163103112 19:15109324-15109346 GCTCAGGTGCTGGAGGTCTGGGG - Exonic
1163244756 19:16086561-16086583 GCGCAGCAGCAGGAAGTGGGAGG + Intronic
1163413595 19:17172239-17172261 CCCCTGGTGCACGAGGTGGGTGG - Intronic
1163666172 19:18605144-18605166 GCGAAGGTGTAGGGGGTGGGGGG - Intronic
1163668448 19:18613816-18613838 GGGGAGGGGCAGGAGGAGGGTGG - Intronic
1163697879 19:18773130-18773152 GCGCTGATGCAGGAGGCAGGCGG + Intronic
1163737700 19:18991491-18991513 GAGGAGCGGCAGGAGGTGGGGGG + Intronic
1164404194 19:27928086-27928108 GCACAGGAGGAGTAGGTGGGAGG - Intergenic
1164581271 19:29436765-29436787 GCGCAGGGGGTGGAGGAGGGGGG + Intergenic
1165145370 19:33726933-33726955 GGGAAGGTGCAGGAGCTGGGAGG - Intronic
1165421099 19:35722371-35722393 GGGCAGATGGAGGAGGTGGCCGG + Exonic
1165776035 19:38404932-38404954 GCGGAGGCACAGGAGGCGGGTGG - Exonic
1165816804 19:38647623-38647645 GCGCAGGCGCGGGCGGAGGGCGG + Intergenic
1165877898 19:39022553-39022575 ACTCAGGAGCATGAGGTGGGAGG - Intronic
1166067415 19:40367906-40367928 CAGCAGGGGCAGGGGGTGGGAGG + Intronic
1166099015 19:40560080-40560102 GCGCTGGAGCAGATGGTGGGAGG + Intronic
1166247178 19:41537588-41537610 GCCTAGGTGCTGGAGCTGGGAGG - Intergenic
1166281892 19:41799693-41799715 GCGCTGGTGCAGGGTGTGAGTGG - Intronic
1166783589 19:45354697-45354719 GAGCAGGTGCAGGGAGGGGGTGG + Intronic
1167056110 19:47112444-47112466 GCGGTGGTGGAGGAGGTGCGGGG + Exonic
1167072725 19:47230403-47230425 GCGCACGTGGCGGCGGTGGGGGG - Intronic
1167475832 19:49700601-49700623 GCGCAGGGGCTGGAGGGGGCTGG + Intronic
1167502667 19:49856571-49856593 GCCCAGAAGCAGGAGGTGGCTGG + Intronic
1167706471 19:51084081-51084103 GAGGACGGGCAGGAGGTGGGCGG + Intronic
1168164015 19:54534184-54534206 ACCCAGGTGGAGGAGGAGGGAGG + Intronic
1168381025 19:55923488-55923510 GCGCAGGAGTAGGGGGTGGAAGG + Intronic
1168414610 19:56160302-56160324 GCGCAGGTGGAGGAGGACGATGG - Exonic
1168435920 19:56316943-56316965 ACTCAGGTGGCGGAGGTGGGAGG - Intronic
1168485645 19:56759927-56759949 GCCCAGGTGCAGCAGGTGCAGGG + Intergenic
925003480 2:424653-424675 GTGGAGGTGGTGGAGGTGGGTGG - Intergenic
925410504 2:3637158-3637180 GTGCAGGAGTAGGAGCTGGGAGG + Intronic
925928176 2:8685366-8685388 GCGCTGGCGCTGGAGGAGGGCGG + Intergenic
926065797 2:9838825-9838847 GCGCAGGTGCATGAGGTGGAAGG - Intergenic
926118044 2:10225628-10225650 GCTCAGGTGCTGCAGCTGGGAGG - Intergenic
926303030 2:11617861-11617883 GCACAGGCGCAGGAGGTGAGGGG - Intronic
927129402 2:20045355-20045377 GGTCAGGTGCCTGAGGTGGGAGG + Intronic
927150719 2:20194252-20194274 GCACAGGGTCAGGAGGTGTGAGG - Intergenic
927561576 2:24077201-24077223 GGGCAGGTGCCGGAGGTGGTGGG + Intronic
928023895 2:27724259-27724281 GCCTGGGTGCAGGAGGTGGAGGG - Intergenic
928198064 2:29229050-29229072 CCGCAGGTGGTGGAGGTGGCTGG - Exonic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
930063652 2:47311132-47311154 TGGCAGGACCAGGAGGTGGGGGG + Intergenic
930364630 2:50424126-50424148 GCGGAGGAGGAGGAGGAGGGGGG + Intronic
931463412 2:62467207-62467229 GGGCAGGTGCAGGGGTGGGGAGG - Intergenic
932063428 2:68529332-68529354 GCACAGGTGCAGGAGCCGCGGGG + Intronic
932144706 2:69307111-69307133 GCACAGGTGGAGGTGGTGGCAGG + Intergenic
932340080 2:70958103-70958125 GGGCAGGTGCTTGAGGTGGCTGG + Exonic
932572614 2:72945917-72945939 GCGTGGGAGCAGGGGGTGGGTGG - Intronic
933063472 2:77767676-77767698 TCGCAGCTTCAGGGGGTGGGAGG - Intergenic
933817713 2:86081462-86081484 CTCCAGGTGCAGGTGGTGGGAGG - Intronic
933902446 2:86859734-86859756 GCAGAGATGCAGGAGTTGGGAGG + Intronic
934649379 2:96082319-96082341 GGGCAGCTGCCGGAGGTGGGGGG - Intergenic
934976861 2:98808870-98808892 GTGCAGCTGCAGGGGATGGGCGG + Intronic
935950434 2:108323875-108323897 GAGCTTATGCAGGAGGTGGGCGG + Intergenic
936964895 2:118117887-118117909 TCGCAGGTAGAGGAAGTGGGTGG + Intergenic
937110986 2:119367085-119367107 GCGAAGGTGCAGCGGGCGGGAGG + Exonic
937870378 2:126782011-126782033 ACCCAGGTGCAGAAGGAGGGAGG - Intergenic
937921538 2:127135086-127135108 GCTCAGGGGCGGGGGGTGGGGGG - Intergenic
939680786 2:145129516-145129538 GCAGAGGTGGAGGAGGTTGGAGG - Intergenic
939956357 2:148530668-148530690 GCGCAGGCCCAAGAGCTGGGTGG - Intergenic
940140757 2:150488261-150488283 GGGTGGGTACAGGAGGTGGGAGG + Intronic
942005417 2:171694798-171694820 GAGCAAGAGCAAGAGGTGGGGGG + Intronic
943047089 2:182872328-182872350 GCAGAGGTGAAAGAGGTGGGTGG - Intergenic
944069185 2:195650951-195650973 GGGAAGGCGAAGGAGGTGGGAGG + Intronic
944809519 2:203314360-203314382 GGGCAGGAGAATGAGGTGGGTGG + Intergenic
945147414 2:206752930-206752952 GGCCAGGGGCAGGGGGTGGGTGG - Intronic
946622056 2:221572066-221572088 GCGCAGGGCCAGGTGGTGCGGGG - Intronic
947035625 2:225851127-225851149 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
947830822 2:233140311-233140333 GAGCAGGTGCGGGGGTTGGGGGG - Intronic
947840725 2:233206121-233206143 GCACAGAGCCAGGAGGTGGGAGG - Intronic
948207096 2:236168137-236168159 GGGCGGGTGCAGGGGGTGTGCGG + Exonic
948424893 2:237880983-237881005 GGGCAGGGGCAGGAGGAGGAGGG - Intronic
948525895 2:238570584-238570606 GGGAAGCTGCAGGAGGCGGGAGG + Intergenic
948737518 2:240018934-240018956 GGGCAGGAGCAGGATGGGGGTGG - Intronic
948742447 2:240056784-240056806 GGGCAGGCGCGGGAGGTGGCGGG - Intergenic
948777980 2:240299671-240299693 GCGCTGGTCCAGGAGATGAGTGG - Intergenic
948813523 2:240498277-240498299 GGGCAGGTGTTGGGGGTGGGGGG + Intronic
948867306 2:240782544-240782566 GGGCAGGTGCGGGAGGCTGGTGG - Intronic
948888769 2:240896894-240896916 GTGCAGGTGCTGGAGGGGGATGG - Intergenic
948932560 2:241141514-241141536 GCCCAGGTGCCCGAGGAGGGTGG - Intronic
1169044372 20:2524491-2524513 GGGCAGGGGCAGGCAGTGGGGGG - Intronic
1169451523 20:5716079-5716101 GCGGAGGTGAAGGAGGTAGAAGG + Intergenic
1169758754 20:9068816-9068838 GCGCAGGGCCCGGCGGTGGGCGG + Intronic
1169996145 20:11558748-11558770 GCACAGTTGCAGCAAGTGGGAGG + Intergenic
1170591559 20:17775665-17775687 GGGCAGCTGCAGGAGTTGGCTGG - Intergenic
1170629656 20:18056510-18056532 GGGCAGGTGCAGGAGCGGCGCGG + Intronic
1170843786 20:19945328-19945350 TCACATGGGCAGGAGGTGGGTGG + Intronic
1171858921 20:30377007-30377029 GCGCAGGTGCTGACGGTGGCGGG - Intergenic
1171876847 20:30585445-30585467 GCGCAGGCGCAGGGGCAGGGAGG + Intergenic
1172013384 20:31859425-31859447 GCAAAGGTGCAGGGAGTGGGGGG - Intronic
1172037040 20:32018245-32018267 GGGCAGGGGCCGGAGGTGTGCGG + Intronic
1172213107 20:33214712-33214734 CCAGAGGTGAAGGAGGTGGGAGG - Intergenic
1172270711 20:33654312-33654334 GGACAGGTGCAGGGAGTGGGTGG + Intergenic
1172864429 20:38084892-38084914 GGGGAGGTGGAGGAGGTGGCAGG - Intronic
1172877917 20:38177285-38177307 GGGCAGCAGGAGGAGGTGGGTGG + Intergenic
1172930037 20:38579936-38579958 GAGCAGCTGCAGGAAGGGGGTGG - Intergenic
1173617660 20:44413596-44413618 GAGTGGGAGCAGGAGGTGGGGGG - Intronic
1173792041 20:45834121-45834143 GCGCAGGAGGAGGAGGGGCGGGG - Intronic
1173910066 20:46661622-46661644 TCCCAGGTGCAGGAAATGGGGGG - Intronic
1174135517 20:48376179-48376201 GGGCAGGGGCCGGGGGTGGGGGG + Intergenic
1174281580 20:49443693-49443715 GAGCAGGTGCTCTAGGTGGGGGG + Intronic
1174402688 20:50284358-50284380 GCGCAGGTGGAGGCCCTGGGTGG - Intergenic
1174671702 20:52314004-52314026 GCGGGGGTGGAGGTGGTGGGGGG + Intergenic
1174799357 20:53550247-53550269 GAGCAGGAGCAAGAGTTGGGTGG + Intergenic
1175431730 20:58909818-58909840 GGGCAAGCGCAGGGGGTGGGCGG - Intronic
1175856045 20:62121839-62121861 GCCCAGGTGCCGGCGGGGGGCGG - Intergenic
1175915692 20:62424743-62424765 GGGCAGGTGCAGGCTCTGGGGGG - Intronic
1176178539 20:63739524-63739546 GCGCGGGCGCGCGAGGTGGGCGG + Intronic
1176263920 20:64198676-64198698 GGCCAGGAGCAGCAGGTGGGAGG - Intronic
1176619172 21:9043192-9043214 GCGCAGGCGCAGGGGGGTGGGGG - Intergenic
1176873464 21:14102733-14102755 GCGCAGGGGAAGGAAGGGGGAGG + Intergenic
1179250149 21:39665254-39665276 GTGGAGGGGCAGGAGGTGGTTGG - Exonic
1179510693 21:41871346-41871368 GTGGTGGTGCAGGAGGTTGGGGG - Intronic
1179804604 21:43829275-43829297 GCGTAGGTGCTGGCGGGGGGTGG - Intergenic
1180109698 21:45642382-45642404 GCGGCAGGGCAGGAGGTGGGGGG - Intergenic
1180297967 22:10961665-10961687 GCGCCGGTGCTGGCGGTGGCGGG + Intergenic
1180626130 22:17194608-17194630 GGCCAGGTGCAGGTTGTGGGGGG - Intronic
1180934975 22:19619514-19619536 GAGCAGGTGGAGGAAGTGGGAGG - Intergenic
1181082319 22:20423790-20423812 GGGCAGAGGCAGGAGGTGGGAGG + Intergenic
1181167110 22:20989705-20989727 GCGCAGGTAGAGGAGGTGAGGGG + Intronic
1181167123 22:20989742-20989764 GCGCAGGTGGAGGAGGTGAGGGG + Intronic
1181437255 22:22918084-22918106 GAGCAGCTGCAGGGGGTTGGGGG + Intergenic
1182442423 22:30372170-30372192 GCGCAGGTGCAGCTGTTGGTGGG + Exonic
1182747391 22:32616188-32616210 GCATGGGGGCAGGAGGTGGGGGG + Intronic
1183185014 22:36286710-36286732 ATCCAGTTGCAGGAGGTGGGTGG - Exonic
1183475656 22:38034475-38034497 GAGCTGGTGCAGGAGGTCGCTGG - Intronic
1183721161 22:39562227-39562249 GGGCAGGTGCAGGGGTGGGGGGG + Intergenic
1184109911 22:42388619-42388641 GCTCAGAGGCAGGAGGAGGGCGG + Intronic
1184380855 22:44144059-44144081 GCGCAGGTTCAAGAGCCGGGTGG - Intronic
1184664202 22:45978766-45978788 GCGCAGGGGCTGGAGGTGGCGGG + Intergenic
1184854832 22:47140882-47140904 GGGCAGGTGCTGGAGTTGGAAGG + Intronic
1185181061 22:49363655-49363677 GCGCTGGAGCAGGAGGTGTCGGG - Intergenic
1185400406 22:50612793-50612815 GAGCAGAGGGAGGAGGTGGGTGG - Intronic
950315109 3:11995215-11995237 TTGCAGTTGCTGGAGGTGGGCGG + Intergenic
950384085 3:12642765-12642787 GGGCAGGGCCAGGGGGTGGGAGG + Intronic
951078578 3:18425359-18425381 GCGGAGGAGGAGGAGGGGGGAGG + Intronic
951619953 3:24590145-24590167 GCTCAGCTTCAGGAGGAGGGGGG + Intergenic
952755221 3:36859682-36859704 GCGCAGCTGCTGGAAGTGTGTGG - Intronic
952906626 3:38143324-38143346 GCTCAGGGGCTGGAGTTGGGGGG - Intergenic
953702763 3:45209596-45209618 GTCCAGGTGCACGGGGTGGGAGG + Intergenic
954121845 3:48504232-48504254 GAGCAGGAGGAGGAGGAGGGAGG + Exonic
954240528 3:49290011-49290033 ACTCAGGTGGATGAGGTGGGAGG + Intronic
954418233 3:50404602-50404624 GCTCAGGGGCAGGACATGGGAGG + Intronic
955274996 3:57538934-57538956 GAGGAAGTCCAGGAGGTGGGGGG - Intronic
955889591 3:63635800-63635822 TCAAAGGTACAGGAGGTGGGCGG + Intergenic
956231015 3:67016864-67016886 GTGCAGGTGGAGGATGTGAGTGG + Intergenic
957206428 3:77204987-77205009 CGGCAGGTGCAGGAGCCGGGCGG + Intronic
961112051 3:124292575-124292597 GTGAAGGTGGAGGTGGTGGGAGG + Intronic
961460161 3:127045122-127045144 GCTCAGGTGCAGGTGGAGGGTGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962650218 3:137480915-137480937 GCCCAGGGGCAGGGGGTGGGTGG - Intergenic
963312215 3:143721487-143721509 GCGCAGGTGCAGGTGTAGGTAGG + Intronic
963785613 3:149531550-149531572 GCGCAGGTGCAGGAGGTGGGAGG - Intronic
964485760 3:157183924-157183946 ACCCAGGTGCAGAAGGTGAGTGG - Intergenic
965587010 3:170327700-170327722 GAGCAGGAGCGGGAGGTGGGGGG - Intergenic
966542011 3:181102565-181102587 GCTCAGGAGATGGAGGTGGGAGG - Intergenic
966864458 3:184249589-184249611 GAGCAACTGCAGGTGGTGGGCGG + Intronic
967937795 3:194742925-194742947 GCTCAGGAGCCTGAGGTGGGAGG - Intergenic
967999189 3:195191239-195191261 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
968092890 3:195909326-195909348 CCGGCGGTGCAGGAGGAGGGCGG - Intronic
968497503 4:926878-926900 GCGCAGGTGAGCGGGGTGGGGGG - Intronic
968548264 4:1209695-1209717 GCGGGGTAGCAGGAGGTGGGTGG - Intergenic
968565554 4:1310802-1310824 AAGCAGGGGCAGGAGGCGGGTGG - Intronic
968613495 4:1567430-1567452 GGGCTGCTGCAGGGGGTGGGAGG - Intergenic
968880270 4:3294970-3294992 GGGGAGGGTCAGGAGGTGGGAGG + Intronic
968920265 4:3518798-3518820 CCTCAGGTGCAGGAGGGGTGGGG + Intronic
968921415 4:3524007-3524029 GCCCAGGGGCAGCAGTTGGGTGG + Intronic
968953810 4:3708209-3708231 GCGCAGTGGCTGGAGGAGGGAGG - Intergenic
969078373 4:4598877-4598899 GGGCAGGTGCAGATGGTGAGCGG + Intergenic
969209742 4:5677675-5677697 GCTCAGGAGGAGGAGGTGGCTGG - Intronic
969351226 4:6599060-6599082 GACCAGGTGCAGGCTGTGGGTGG - Intronic
969402840 4:6968292-6968314 GGGCAGGCGCAGGAGGAGTGGGG + Intronic
969479768 4:7441669-7441691 GGGCTGGGGCAGGAGGTGGAGGG - Intronic
969681467 4:8645599-8645621 GCCCGGGTGGAGGTGGTGGGAGG + Intergenic
971131933 4:23820998-23821020 CCATAGGTGCAGCAGGTGGGTGG - Intronic
972667790 4:41183825-41183847 GGGGAGTTGCAGGGGGTGGGAGG + Intronic
974009986 4:56597969-56597991 GCTCAGGTGGCTGAGGTGGGAGG - Intronic
974061055 4:57036294-57036316 AGGCAGGAGGAGGAGGTGGGGGG + Intronic
975106240 4:70571870-70571892 GCACACGTGTAGGAGGTGGGTGG + Intergenic
975281717 4:72569289-72569311 AGGCAGGCGGAGGAGGTGGGAGG + Intergenic
975505726 4:75134572-75134594 ACTCAGGAGCCGGAGGTGGGAGG + Intergenic
977099685 4:92795130-92795152 GAACAGGTGGAGGAGGTGGAAGG + Intronic
978638273 4:110837990-110838012 GTGCAGGTGCAGCAGCTGGAAGG + Intergenic
981463904 4:145044062-145044084 GTGCTGGTGCAGGAGGAAGGGGG - Intronic
981666617 4:147234239-147234261 GAGGAGGTGGAGGAGGTGGAAGG + Intergenic
982215656 4:153080717-153080739 GAGGAGGTGCAGGAGGGGAGTGG - Intergenic
982358092 4:154491057-154491079 GCGCAGCAGCAGGAGGGGAGCGG - Intronic
982817494 4:159904726-159904748 ACACAGGTGCCAGAGGTGGGTGG + Intergenic
983141415 4:164154607-164154629 GGGCAGGTGCAGGAAATGAGGGG + Intronic
984864943 4:184273315-184273337 GCTCAGGAACAGAAGGTGGGAGG - Intergenic
985493349 5:191753-191775 GCGCAGGTCCTGGGGGTGGTCGG - Exonic
985563157 5:602089-602111 CCGCAGCTGCAGGAGCTGGGCGG - Intergenic
985973356 5:3394378-3394400 GGGCAGGTGCAGGAGCGGTGCGG - Intergenic
986195148 5:5531594-5531616 GCACAGCTGGGGGAGGTGGGTGG - Intergenic
986210347 5:5665688-5665710 GAGGAGCTGCAGGAGGTGGAGGG + Intergenic
986763167 5:10898385-10898407 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
987113352 5:14707644-14707666 TGGGAGGTGCAGGGGGTGGGGGG - Exonic
987352232 5:17032433-17032455 GCGCAGGTGGAGGTGGTTGATGG + Intergenic
989212097 5:38866368-38866390 GCCCTGATGCTGGAGGTGGGGGG + Intronic
992483782 5:77176502-77176524 GGGCATGAGCAGGAGGAGGGTGG + Intergenic
992833183 5:80615292-80615314 TGGCAGGTGGAGGTGGTGGGAGG - Intergenic
992912338 5:81408167-81408189 GAGGAGGAGGAGGAGGTGGGGGG + Intergenic
993330962 5:86599343-86599365 GAGCAGGTGCAAGAGATGGCGGG - Intergenic
996712110 5:126553701-126553723 ACGCAGGAGCCTGAGGTGGGAGG + Intronic
997360372 5:133291017-133291039 GCGCAGGCTCAGGAGATGGGTGG - Intronic
997369418 5:133348567-133348589 GGCCAGGTGCAGGAGCTGAGGGG + Intronic
997372893 5:133373308-133373330 GGGGTGATGCAGGAGGTGGGCGG + Intronic
997387718 5:133486751-133486773 GAGCAGGAGCTGGCGGTGGGTGG + Intronic
997416510 5:133732663-133732685 GCGCAGGATCTGGAGCTGGGCGG - Intergenic
997443055 5:133922108-133922130 GCTCAGGTGCAGGCAGTGTGAGG + Intergenic
997591621 5:135076674-135076696 GGGAAGGGGCAGGAGTTGGGGGG + Intronic
998161455 5:139814963-139814985 GGCCAGGGGCAGGTGGTGGGTGG - Intronic
998161841 5:139817366-139817388 GAGCAGGTCTAGGGGGTGGGTGG + Intronic
998349685 5:141492508-141492530 GCGCAGGTGGGAGAGGTGAGAGG - Intronic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
998451146 5:142235594-142235616 GCAAAGGAGCAGGAGGAGGGGGG - Intergenic
999143740 5:149379406-149379428 GCGCAGTGGCAGGCGGTGAGGGG + Intronic
999232550 5:150070148-150070170 GCCCAGGTGAGGGAGGTGAGTGG + Intronic
999694046 5:154172665-154172687 GCGAGGGTGCAGGAGGTGGAAGG + Intronic
999754479 5:154654002-154654024 GAGGAGCTGCAGGTGGTGGGTGG - Intergenic
1000784156 5:165523364-165523386 GGGAAGGTCCAGGTGGTGGGAGG - Intergenic
1001247777 5:170117955-170117977 GGGCAGGAGCAGAAGATGGGTGG + Intergenic
1001483789 5:172105648-172105670 GCGCAGCTGCTGGAGGTGAGTGG - Exonic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001962842 5:175890641-175890663 GCACAGGTGCAGGAGGGAGGAGG - Intergenic
1002198677 5:177514658-177514680 TCGCAGGTGGCAGAGGTGGGGGG + Intronic
1002421224 5:179150115-179150137 GAGCAGGAGCAGGAGCTGGTGGG - Intronic
1002570239 5:180136017-180136039 GGGCAGGGGCAGGAGGGGGTAGG + Intronic
1002860498 6:1075477-1075499 GGGCAGGTGCAGGAGCTGGAAGG - Intergenic
1003507269 6:6750311-6750333 GCAGAGGTGCAGGGGGAGGGGGG + Intergenic
1003872770 6:10415083-10415105 GCGCAGGAGGAGGAGGAGGAGGG + Exonic
1004065898 6:12243375-12243397 GAAGAGGTGGAGGAGGTGGGAGG + Intergenic
1004264792 6:14139839-14139861 GCCCAGGTGGAGGAGGGAGGAGG + Intergenic
1004811218 6:19265853-19265875 AAGCAGGAGGAGGAGGTGGGGGG + Intergenic
1005333936 6:24774863-24774885 GCGCAGGCGCAGGAAGGGGCGGG + Intergenic
1005495449 6:26383859-26383881 GAGCAGGAGGAGGAGGAGGGAGG - Exonic
1005671504 6:28110475-28110497 GGGCAGTTTCAGGAGGTGGATGG + Intergenic
1006453307 6:34117774-34117796 GGTGAGGAGCAGGAGGTGGGAGG - Intronic
1006644394 6:35506015-35506037 GTCCAGGTGCAGGAAGTAGGAGG + Exonic
1007371184 6:41427855-41427877 GCGCAGGGGCAGGGGGAGCGGGG + Intergenic
1007623495 6:43229161-43229183 GCGCAGCTGCCGGGGGTCGGGGG + Intronic
1007705364 6:43787528-43787550 GGGCAGGGGCAGGGAGTGGGTGG + Intergenic
1007727813 6:43927253-43927275 GCACAGGTGCACCAGGTGGGTGG - Intergenic
1013071097 6:106729996-106730018 GAGCAGGTGGAGAAGGAGGGAGG + Intergenic
1013188719 6:107783956-107783978 GGGCAGGGGCAGGAGGTGGCAGG - Intronic
1014443461 6:121499430-121499452 ACACAGGTGGATGAGGTGGGAGG - Intergenic
1014493061 6:122086525-122086547 GAGCAGGAGGAAGAGGTGGGGGG + Intergenic
1014556414 6:122846208-122846230 GGGTAGGGGTAGGAGGTGGGGGG - Intergenic
1015744186 6:136492091-136492113 GGCCAGGGGCAGGGGGTGGGGGG + Intronic
1015759535 6:136644012-136644034 GTCCAGGAGCAGGAGGTGGGAGG + Intronic
1016964529 6:149706399-149706421 GCTCAGGTGACTGAGGTGGGAGG + Intronic
1017150459 6:151274413-151274435 GTGATGGTGGAGGAGGTGGGGGG + Intronic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1017690167 6:156956158-156956180 TAGCAGGGGAAGGAGGTGGGAGG + Intronic
1018270155 6:162068804-162068826 GAGCATGTACAGGAGGTGGTGGG + Intronic
1018309243 6:162491487-162491509 GCGCAGCTGCAGGCAGTGGCTGG - Intronic
1018405176 6:163473364-163473386 GCCTAGATTCAGGAGGTGGGAGG + Intronic
1018747707 6:166775254-166775276 GCGAAGGGGCCGGGGGTGGGGGG - Intronic
1018790194 6:167142375-167142397 GAGCAGGTGCAGGCGCTGGGAGG - Intergenic
1018924284 6:168195528-168195550 GAGCAGGGGGAGGAGGAGGGAGG - Intergenic
1018946720 6:168352403-168352425 GAGCAGGAGAAAGAGGTGGGGGG + Intergenic
1019310810 7:359768-359790 GCCCTGGTGCAGGAGGTGCCAGG - Intergenic
1019336244 7:484421-484443 GAGCAGGTGGAGGAGGGGAGGGG - Intergenic
1019366734 7:636930-636952 GGCCAGGTGCTGAAGGTGGGGGG + Intronic
1019420289 7:947723-947745 GCGCGGGAGCGGGAGGTGGGTGG - Intronic
1019775574 7:2910198-2910220 TCACAGGAGCGGGAGGTGGGTGG - Intronic
1019789462 7:3001578-3001600 CGGCAGGTGGAGGGGGTGGGAGG - Intronic
1020029079 7:4920353-4920375 GGACAGGTGCAGCAGCTGGGTGG + Intronic
1020044620 7:5031782-5031804 GAGGAGTTGGAGGAGGTGGGTGG - Intronic
1020239785 7:6384711-6384733 GCACAGGGGCCTGAGGTGGGAGG - Intronic
1020937374 7:14484503-14484525 TAGCAGGAGCAAGAGGTGGGGGG - Intronic
1021276487 7:18657974-18657996 GCGCAGCTCCTGGAGGTGGAAGG - Intronic
1021724015 7:23532422-23532444 GCGCGGGAGCCTGAGGTGGGAGG - Intergenic
1022873494 7:34504001-34504023 GAGCAGGAGCAAGAGGAGGGAGG + Intergenic
1023565186 7:41517071-41517093 CTGTAGGTGCAGGAGGTGTGAGG - Intergenic
1024096564 7:45987149-45987171 GGGGAGGTGCAGGAGGTTGGAGG + Intergenic
1026522785 7:71131657-71131679 GCGCAGGTGGCGGCGGAGGGCGG - Intergenic
1027244782 7:76359393-76359415 GCGCAGGCGCAGGAGGACGGGGG + Intergenic
1027268359 7:76506053-76506075 GCTCTGATGCAGGAAGTGGGGGG - Intergenic
1028243443 7:88448713-88448735 GAGGAGCTGCAGGAGGCGGGAGG - Intergenic
1029086564 7:98016427-98016449 GGGCAGGGGAGGGAGGTGGGTGG + Intergenic
1029220782 7:98988591-98988613 TCCCAGGGGCTGGAGGTGGGAGG + Intronic
1029397742 7:100319794-100319816 GAGGAGTTGGAGGAGGTGGGTGG + Exonic
1029684335 7:102135444-102135466 GAGGACGTGGAGGAGGTGGGAGG + Intronic
1029702834 7:102258895-102258917 GCGCTCGGGCTGGAGGTGGGGGG + Intronic
1030463800 7:109874512-109874534 GTGCAGGGGCAGGAAGTGGATGG + Intergenic
1032093289 7:128922902-128922924 GGGCAGGTACAGGGGCTGGGGGG - Intergenic
1032174526 7:129612211-129612233 GCCCGGGAGCGGGAGGTGGGCGG + Intronic
1032365952 7:131300267-131300289 GAGCAGGTGAAGGAGATGGCAGG + Intronic
1032473964 7:132199824-132199846 GGGGATGTGTAGGAGGTGGGAGG - Intronic
1032570270 7:132988668-132988690 GCTCAGGAGGATGAGGTGGGAGG + Intronic
1032628824 7:133624472-133624494 GCTCAGGAGCTTGAGGTGGGAGG + Intronic
1034276632 7:149826703-149826725 GTGCAGGGGCAGGCAGTGGGAGG - Intergenic
1034818939 7:154198980-154199002 GCCCAGGTGAAGGATTTGGGAGG - Intronic
1034934706 7:155191323-155191345 GCGCAGGTGCAGAGGACGGGTGG + Intergenic
1035202684 7:157277294-157277316 GAGTGGCTGCAGGAGGTGGGGGG - Intergenic
1035244348 7:157552503-157552525 GCCGAGGTGCAGGATGAGGGAGG + Intronic
1035322776 7:158044383-158044405 ATGCAGGTGCAGGATGTGCGGGG - Intronic
1035528739 8:335011-335033 GGACAGGTGCAGGCAGTGGGAGG + Intergenic
1035552986 8:544585-544607 GCGCAGGTGGAGGGCGAGGGTGG - Intronic
1035727753 8:1835118-1835140 GCGCAGACACAGGATGTGGGTGG + Intronic
1035737337 8:1898257-1898279 GAGCAGGTGCAGAAAGTGGCTGG + Intronic
1035864873 8:3071053-3071075 GAACAGGAGCAAGAGGTGGGTGG + Intronic
1036668111 8:10761247-10761269 GAACAGGTGGAGGAGGAGGGAGG + Intronic
1036700695 8:11011941-11011963 GAGATGGTGCAGGAGGTGGCAGG + Intronic
1037748298 8:21663429-21663451 GCTCAGGTGCAGGAGGGCAGAGG + Intergenic
1037876621 8:22551839-22551861 GCGCCGGCGCAGGAAGAGGGAGG - Exonic
1038055973 8:23858053-23858075 GCCCAAGTGCAGTGGGTGGGAGG + Intergenic
1038260042 8:25984889-25984911 TCTCAGTTTCAGGAGGTGGGTGG - Intronic
1038408522 8:27340744-27340766 GAGCTGGTGCAGCAAGTGGGAGG + Intronic
1038694915 8:29797926-29797948 GGGCAGGTGTAGGATGTGGGTGG + Intergenic
1038789743 8:30658004-30658026 GCGGAGGCGCAGGAAGGGGGCGG - Exonic
1039619349 8:38982302-38982324 ACCCAGGGGCTGGAGGTGGGAGG + Intronic
1040415815 8:47194422-47194444 GCGCAGGTGCAGACTGTGGTTGG - Intergenic
1040881153 8:52206047-52206069 GCACGGCTGCAGGAGGTGCGGGG + Intronic
1042188143 8:66157216-66157238 GGGCAGGTGGAGCAGGTGTGGGG + Intronic
1042516321 8:69662991-69663013 GGGCGGGAGCAGGAGCTGGGTGG - Intergenic
1043161523 8:76853086-76853108 CAGAAGGTGGAGGAGGTGGGGGG - Exonic
1043301823 8:78744001-78744023 ACGCACCTGCAGGAGGTGGCTGG + Intronic
1044106101 8:88209204-88209226 GAAGAGGTGCAGGAGGTGGAAGG - Intronic
1044320071 8:90791689-90791711 GCGCAGAGGCCGGAGGAGGGAGG + Exonic
1044774031 8:95669141-95669163 ACACAGGTGCATGAGGTCGGGGG + Intergenic
1045012057 8:97967039-97967061 GAGCAGGAGCAAGAGGTAGGGGG + Intronic
1046547214 8:115667964-115667986 GCGGAGGAGCTGGAGGTGGTTGG - Intronic
1048195572 8:132329287-132329309 GGGCTGGTGGAGGAGGTGAGTGG - Intronic
1048648658 8:136450659-136450681 GCGCAGGTGCAGAGGCTGTGGGG + Intergenic
1049196887 8:141320646-141320668 GTGCAGGTGCAGGGACTGGGTGG + Intergenic
1049199014 8:141330911-141330933 GCCCTGGTGCAGGAGGTTGTGGG + Intergenic
1049377148 8:142294673-142294695 GCACAGCTGCAGGAGCTCGGAGG + Intronic
1049558640 8:143296508-143296530 GCGCTGGTGCTGGAGGAGGTTGG - Exonic
1049672205 8:143874954-143874976 GCCCATGTGGTGGAGGTGGGTGG - Intronic
1049784136 8:144442541-144442563 GCACAGGTGTGAGAGGTGGGGGG + Intronic
1049925079 9:400469-400491 GTGATGGTGAAGGAGGTGGGTGG - Intronic
1049978303 9:881112-881134 GCACAGGAGGAGGAGGTGGGGGG - Intronic
1050217719 9:3346697-3346719 GCTCAGGTGCAGTATGTGGAAGG - Exonic
1051436617 9:17040419-17040441 GAACAGGAGCAGAAGGTGGGTGG - Intergenic
1052193542 9:25684763-25684785 AAGCAGGAGCAAGAGGTGGGGGG - Intergenic
1052413234 9:28148096-28148118 GCACAGGTGCAGGAGCCGCGGGG - Intronic
1053136104 9:35651001-35651023 GCGCAGGTGCAGGCACAGGGCGG - Intergenic
1053436949 9:38082076-38082098 GCCCAGGTCCAGGAGCTGGGTGG - Intergenic
1053459060 9:38254408-38254430 GGGCTGGAGCAGGGGGTGGGGGG + Intergenic
1055013724 9:71593897-71593919 GCGTAGGTCCAGAAAGTGGGAGG + Intergenic
1055107035 9:72523680-72523702 GTAGAGGTGCAGGAGGTGGAAGG + Intronic
1055275906 9:74615398-74615420 GCTCAGGCGCAGAAGGTGGGAGG - Intronic
1055382540 9:75724614-75724636 TCACATGGGCAGGAGGTGGGTGG + Intergenic
1055486672 9:76763033-76763055 GAGATGGTGCACGAGGTGGGAGG - Intronic
1056020377 9:82432998-82433020 GCACAGGTGCAGGAGCCGCGGGG + Intergenic
1057071519 9:92104310-92104332 GCACAGGTGCAGGAGCCGCGGGG - Intronic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1057245601 9:93451874-93451896 GCGCGGGTGCGGGCGGGGGGCGG - Exonic
1057387137 9:94614186-94614208 GAGCAGGGGGAGGAGGAGGGAGG + Intronic
1058958504 9:109971000-109971022 ACTCAGGTGGATGAGGTGGGAGG + Intronic
1059072442 9:111152888-111152910 GTGGAGGTGGAGGAGGAGGGAGG + Intergenic
1059766263 9:117386622-117386644 GGGCAGGTGCAGGAAGCAGGAGG + Intronic
1060927184 9:127463250-127463272 GCCCAGGTGCAGGAGGCAGGTGG + Intronic
1061084300 9:128390284-128390306 GAGCAGCTGCTGGCGGTGGGGGG - Exonic
1061153928 9:128845763-128845785 GAAGAGGAGCAGGAGGTGGGTGG + Intronic
1061218256 9:129234553-129234575 GCACAGGTGGAGGATGTGGACGG - Intergenic
1061255885 9:129454057-129454079 GTGGAGGTGGAGGTGGTGGGTGG + Intergenic
1061256094 9:129454635-129454657 GCGGAGGTGGAGGTGGTGGATGG + Intergenic
1061681565 9:132245055-132245077 CCCCTGGTGCAGAAGGTGGGCGG + Intergenic
1061849236 9:133404806-133404828 GTGGTGGTGCAGGAGGAGGGCGG + Exonic
1061874965 9:133539099-133539121 GCGCACGTGCAGGGAGTGAGGGG + Intronic
1061880727 9:133567668-133567690 GCAAACGTGCAGGAAGTGGGAGG - Intronic
1061913437 9:133737241-133737263 GCACTGGGGCAGGAGATGGGGGG - Intronic
1061972059 9:134050291-134050313 GGGCAGGAGCAGCAGGCGGGGGG - Intronic
1062016783 9:134295016-134295038 CCGCAGGTGGGGGTGGTGGGGGG + Intergenic
1062086028 9:134648952-134648974 ACGGAGGTCCAGGAGGTGGATGG + Intronic
1062255517 9:135619019-135619041 GCCAAGGTGAAGGAGGTGGAAGG - Intergenic
1062340262 9:136090950-136090972 GCACAGGGGCAGGAGCTGGGCGG + Intronic
1062349810 9:136133196-136133218 GGGCGGCTGCAGGAGCTGGGCGG - Intergenic
1062590338 9:137271802-137271824 GCCCAGGGACAGGAGGAGGGTGG - Intronic
1185652919 X:1661722-1661744 GAGCAGGTGCAGGGGCTAGGGGG - Intergenic
1185735075 X:2490057-2490079 GCCCAGGCCCAGGAAGTGGGCGG + Exonic
1186455295 X:9705999-9706021 GAGCAGGGGCAAGAGGTGGGAGG + Intronic
1186545936 X:10449557-10449579 GCCCACGCGCCGGAGGTGGGGGG + Exonic
1189263924 X:39699308-39699330 GAGCAGGACCAGGAGATGGGGGG + Intergenic
1189311019 X:40017631-40017653 ACGCAGGAGCCTGAGGTGGGAGG - Intergenic
1189414929 X:40805063-40805085 GCCCAGGTGCCCGAGCTGGGAGG + Intergenic
1189923796 X:45931744-45931766 GCTCAGGAGGATGAGGTGGGAGG - Intergenic
1190128242 X:47724403-47724425 GGTCAGGGGCAGGATGTGGGTGG + Intergenic
1192564387 X:72151497-72151519 GCACAGGAGCAGGTGGAGGGGGG + Intergenic
1192808059 X:74527191-74527213 GGGCAGGAGCAGTGGGTGGGTGG - Intronic
1193933108 X:87581440-87581462 ACGCACCTGTAGGAGGTGGGTGG - Intronic
1196046548 X:111261793-111261815 GGTGAGGTGGAGGAGGTGGGAGG - Intronic
1197288180 X:124621226-124621248 GCACTTGTGCAGGAGGCGGGCGG + Intronic
1197782482 X:130171848-130171870 GCGCTGGAGGAGGAGGAGGGGGG + Exonic
1198236670 X:134742016-134742038 TCACAGGTGCAGGGGCTGGGTGG + Intronic
1199331563 X:146566617-146566639 GAGCAGGTACAGGAGGTCAGAGG + Intergenic
1200099860 X:153685054-153685076 GAGCATGTGCAGGAGGGGGTGGG - Intronic
1200154880 X:153970142-153970164 GAGCAGGCGCAGGAGAAGGGAGG + Intronic
1202050580 Y:20776324-20776346 GGGCAGTAGCAGGATGTGGGTGG + Intronic