ID: 963785978

View in Genome Browser
Species Human (GRCh38)
Location 3:149534829-149534851
Sequence CTTTCCTAGCAGCTGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 2, 2: 1, 3: 41, 4: 394}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963785978 Original CRISPR CTTTCCTAGCAGCTGGAGGA CGG Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
901789745 1:11647936-11647958 CCTTCCAAGCAGCTGGGGGAGGG + Intergenic
902134347 1:14292017-14292039 TCTTCATAGCAGCTTGAGGATGG + Intergenic
902652273 1:17844618-17844640 CTTTCCAAGCCTCTGGAGGGAGG - Intergenic
902820067 1:18938323-18938345 CCTTCCCAGCAGCTGGAGGTGGG - Intronic
904329077 1:29746213-29746235 CTTTCCTTCCAGCTGCAGAAGGG - Intergenic
904659273 1:32072788-32072810 CTTCACCAGCAGCTGCAGGAAGG + Intronic
904772582 1:32888648-32888670 CTTTCCTGGGAGAGGGAGGAAGG - Intronic
904814110 1:33182179-33182201 CTTCCCTGGGAGCTGGAGGATGG - Intergenic
908031836 1:60008865-60008887 AATGCCAAGCAGCTGGAGGAAGG - Intronic
909457938 1:75870763-75870785 CTTTCTTAGCAGCATGAGAAAGG + Intronic
909510913 1:76451185-76451207 CTTTCTTAGCAGCATGAGAATGG - Intronic
910115277 1:83724840-83724862 CTCTCCGAGAAACTGGAGGAGGG + Intergenic
910397415 1:86806470-86806492 CTCTCTTAGCCGCTCGAGGAAGG + Intergenic
911972944 1:104460632-104460654 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
912684693 1:111753121-111753143 CTTTCCAGGGAGCTAGAGGAGGG - Intronic
912816355 1:112831833-112831855 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
913084996 1:115428761-115428783 CTTTCATAGAAGCTGGAATATGG + Intergenic
913448015 1:118970519-118970541 CTTTCCAAGCAGCAGCAGGAAGG + Intronic
915156586 1:153881688-153881710 CTTTTCTGGAAGCTAGAGGAAGG - Intronic
916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG + Intergenic
918197308 1:182234517-182234539 CTTTTCTAGCACCTGGAAAATGG - Intergenic
918472829 1:184892411-184892433 CTTTCAGAGGAGCTTGAGGAGGG - Intronic
918646780 1:186915244-186915266 ACTTGCTAGCAGCTGAAGGAGGG - Intronic
919108473 1:193186503-193186525 GTTGCCTGGCAGCTGCAGGAAGG + Exonic
919664923 1:200282753-200282775 CTTTCTCAGCAGCAGGAGGGAGG + Intergenic
920111737 1:203591904-203591926 CTTGCCTAGAGGCTGGGGGAAGG + Intergenic
920204001 1:204278205-204278227 CTTGCCTAGAAGCAGGGGGATGG - Intronic
920325141 1:205157133-205157155 CTTTACTAGCAGCGTGAGAATGG + Intronic
920445450 1:206012682-206012704 GTTTCCTAGGAGCCGGGGGAGGG - Intronic
921948535 1:220905954-220905976 CTTTCCTTGAAACTGGAGGAGGG - Intergenic
924095331 1:240545160-240545182 CTTTCCCAGTGGTTGGAGGATGG - Intronic
924259191 1:242212215-242212237 TTTTCCTATCTACTGGAGGAGGG - Intronic
1063638558 10:7809155-7809177 CTCTCCTAGAAACTGGAGGTGGG - Intergenic
1064156040 10:12904102-12904124 ATTTCATGGGAGCTGGAGGAGGG + Intronic
1064300744 10:14120649-14120671 CTTTCCTTGCAGTTAGTGGAGGG + Intronic
1065967298 10:30780555-30780577 CTTTTCTAGCAGGTGGGGCATGG + Intergenic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1067669012 10:48302928-48302950 CAGTTCTTGCAGCTGGAGGATGG + Intergenic
1068673618 10:59747737-59747759 CTTTCCTAGAAGGTAGGGGACGG + Intergenic
1069137301 10:64782131-64782153 CTCTCGTAGCCGCTCGAGGAAGG + Intergenic
1069599601 10:69694968-69694990 GAGTCCCAGCAGCTGGAGGATGG - Intergenic
1070214565 10:74363514-74363536 GTTCCCTAACAGCAGGAGGAGGG + Intronic
1070310460 10:75269817-75269839 CCTCCCTTGCAGCTGGGGGAGGG - Intergenic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1070804252 10:79261466-79261488 CTTCCAGAGCAGCTGGGGGAGGG - Intronic
1070836158 10:79448171-79448193 CATTCCCAGCAGCTGGCTGAGGG - Intergenic
1075112522 10:119598613-119598635 CTTTTCTTGAAGATGGAGGATGG - Intergenic
1075424678 10:122332424-122332446 TTTTCCTTTCAGCTGGAGAATGG + Exonic
1076314868 10:129532949-129532971 GTGTCCGAGCAGCTGCAGGAAGG - Intronic
1076720363 10:132389710-132389732 CTCTCCTGGCCACTGGAGGAGGG + Intergenic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1078157287 11:8809855-8809877 CTTTCCTAAGAGGTGGAGGAGGG - Intronic
1078937844 11:15967581-15967603 ATTTGCTACAAGCTGGAGGAGGG + Exonic
1080596760 11:33780026-33780048 CAGTTCTAGCAGCTGGAGGGAGG - Intergenic
1081146041 11:39563357-39563379 CTTCCATAGCCGCTTGAGGAAGG - Intergenic
1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG + Intronic
1081421466 11:42877648-42877670 CTCTCATAGCCGCTCGAGGAAGG - Intergenic
1081460983 11:43272819-43272841 CTTTATTAGCAGCTTGAGAAGGG + Intergenic
1083197575 11:61097963-61097985 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
1083738527 11:64695230-64695252 CTTTTCCAGCAGTGGGAGGAGGG - Intronic
1083925081 11:65801208-65801230 CGTTCCCAGCAGCTGGGGCATGG - Intergenic
1084211051 11:67622710-67622732 CTCTCATAGCCGCTCGAGGAAGG - Intergenic
1084481711 11:69425070-69425092 GTTTCCCAGGAGCAGGAGGAGGG + Intergenic
1084732856 11:71084547-71084569 CTGTTCTAGCACCTGGAGAATGG - Intronic
1085445691 11:76599283-76599305 GGTTCTTAGCAGCTGGGGGAGGG - Intergenic
1086973066 11:93104394-93104416 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
1086998161 11:93383445-93383467 GGTTGCTAGGAGCTGGAGGAAGG + Intronic
1088162958 11:106895704-106895726 CTTTCTTAGCAGCATGAGAATGG + Intronic
1088321167 11:108555913-108555935 CTTTCATAGCAGCGTGAGAACGG + Intronic
1088561575 11:111120856-111120878 CTGTCCTTGGAGCTGGAGGGTGG - Intergenic
1089064420 11:115651628-115651650 ATTTGCCAGGAGCTGGAGGAAGG - Intergenic
1089189319 11:116642760-116642782 CATTCCTAGGGGCTGGAGGATGG + Intergenic
1091768610 12:3137582-3137604 CTTTCCAGCCAGATGGAGGAGGG + Intronic
1093250208 12:16793565-16793587 ATTTCCTTGCAGATGTAGGATGG - Intergenic
1093299547 12:17438111-17438133 CTTTCCTATCAGCTTGATGGGGG - Intergenic
1093580540 12:20780617-20780639 CTCTCGTAGCTGCTCGAGGAAGG + Intergenic
1093585918 12:20835895-20835917 TCTTCCTAGCAGCAGGAGAATGG - Intronic
1093885386 12:24453683-24453705 CTTTCCTAGCTGCTGGATGTAGG - Intergenic
1093981077 12:25476426-25476448 CTTTTCTAGTAGCTGGTTGAGGG + Exonic
1095540415 12:43303440-43303462 CTTTATTAGCAGCTTGAGAATGG - Intergenic
1095921839 12:47539571-47539593 CTTTCAGAGCTGCTGGATGATGG + Intergenic
1097146387 12:56942282-56942304 CTTTCCCTGCCACTGGAGGAGGG + Intergenic
1098248787 12:68547083-68547105 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
1098749042 12:74272163-74272185 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
1100107612 12:91196035-91196057 CTTTATTAGCACCTTGAGGATGG - Intergenic
1100964957 12:100002503-100002525 CTTGCCTTGCAGCTGGGGGTGGG - Intergenic
1102158714 12:110751319-110751341 CTATCCCAGCATCTGGAGGGTGG + Intergenic
1102397620 12:112600803-112600825 CTTTATTAGCAGCATGAGGACGG - Intronic
1102731855 12:115118571-115118593 CTTTATTAGCAGCTTGAGAATGG - Intergenic
1103151494 12:118643357-118643379 CTTTCCTAGCATGTGGCAGACGG + Intergenic
1103266495 12:119635051-119635073 TTTCCCTAGCAGCTTGAGGGCGG - Intronic
1103437364 12:120937244-120937266 CACTCCTAGCAGCTGGGGAATGG - Intergenic
1104128508 12:125870284-125870306 CTTTATTAGCAGCTTGAGAACGG + Intergenic
1105059374 12:133134399-133134421 CTGGCCTTGCAGGTGGAGGAAGG + Intronic
1105207968 13:18238895-18238917 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1105759821 13:23503493-23503515 GTTTCCTTGCACCTGGAGGAGGG - Intergenic
1106027305 13:25967433-25967455 CTTTCCTTGAAGGTGGAGGGTGG + Intronic
1106979546 13:35261387-35261409 CATCCCTAGCAGCTGGACTACGG - Intronic
1109391846 13:61704490-61704512 CCATTCTAGCATCTGGAGGATGG - Intergenic
1110374569 13:74777571-74777593 TTTTCCTTCCAGCTGGAGGTGGG - Intergenic
1114541704 14:23465586-23465608 CTTGCCTTGCAGCAGAAGGAAGG - Intergenic
1114674945 14:24433667-24433689 CTTGCCTAGCACCTTGAGCAAGG - Intronic
1115219543 14:31045925-31045947 CTTTCCTGGAGGCTGGAGGGTGG - Intronic
1115491777 14:33965003-33965025 CTTTCCTGGAAGCTGGAGGGTGG + Intronic
1116240662 14:42338617-42338639 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
1116287005 14:42986678-42986700 CTTTACTAGCAGCATGAGAATGG - Intergenic
1117080071 14:52142707-52142729 CTTTCCTTCCAACTGGAGGTGGG + Intergenic
1117447677 14:55820420-55820442 ACTTACTAGCAGCTGAAGGAGGG - Intergenic
1118051000 14:62027821-62027843 CTTTTCAAGCAGCTTGGGGAAGG - Intronic
1118259506 14:64234308-64234330 CTTGCCCTGGAGCTGGAGGAGGG - Intronic
1118524577 14:66624529-66624551 CTGTCCTTGGAGCTGGAGGGTGG - Intronic
1119228025 14:72958916-72958938 CTCTCCTAGCAGCCAGAGGATGG - Exonic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1122365571 14:101193117-101193139 CTTTCCTAGCAGATGGGGAAAGG - Intergenic
1123508004 15:20964846-20964868 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1123565222 15:21538588-21538610 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1123601485 15:21975875-21975897 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1124111161 15:26789946-26789968 CCGTCTTAACAGCTGGAGGAAGG - Intronic
1126464063 15:48944450-48944472 TTTTCCAAGCAGCAGGAAGAAGG - Intronic
1126807000 15:52360973-52360995 CTTTTCCAGCAGCTGGGGAAAGG - Intronic
1127095825 15:55511567-55511589 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
1127187558 15:56494949-56494971 CTTTTCCAACAGCTGGATGATGG - Intergenic
1128016946 15:64356085-64356107 CTTTCCCAGGAGCGGGAGGGAGG + Exonic
1128026079 15:64437811-64437833 TTGTCCTGGCAGCTGTAGGAAGG + Intronic
1128375320 15:67070211-67070233 CCTCCCTAGCAGCTGGAAGGGGG - Intronic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1128783416 15:70377669-70377691 ATTTCCTAGCAACTGCAGAATGG + Intergenic
1129057097 15:72827954-72827976 ACTTCATGGCAGCTGGAGGATGG + Intergenic
1129166946 15:73784072-73784094 CTTTATTAGCAGCAGGAGAATGG + Intergenic
1131365339 15:91834390-91834412 ATTTCCCAGCAGCTAGAGGAAGG - Intergenic
1202973593 15_KI270727v1_random:265694-265716 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1133418273 16:5623641-5623663 CATTACAAGCAGCTGGGGGAAGG - Intergenic
1133966652 16:10536641-10536663 CTTTATTAGCAGCTTGAGAATGG + Intronic
1135953070 16:26933386-26933408 CTTCACTAGCAGATGGAGAACGG - Intergenic
1136085550 16:27882337-27882359 CTTTACTAGCAGCATGAGAATGG + Intronic
1136136971 16:28262142-28262164 GTTTCTTTGCTGCTGGAGGAGGG + Intergenic
1136577890 16:31135125-31135147 CTTTCCTCGGAGAGGGAGGAGGG - Intronic
1140404874 16:74702255-74702277 CACTCATAGCAGCTGCAGGATGG + Intergenic
1141299727 16:82802782-82802804 CTTTCCTGGCAGCTTGAAGAGGG - Intronic
1143635116 17:8159970-8159992 CTTACATACCAGCTGGGGGAGGG + Exonic
1144160573 17:12553696-12553718 CATCCCCAGAAGCTGGAGGAAGG - Intergenic
1146764558 17:35507479-35507501 ACTTGCTAGCAGCTGAAGGAGGG + Intronic
1147437093 17:40423223-40423245 CTTTCCCAGCAGAAGGAGGCTGG + Intergenic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1148392752 17:47284702-47284724 CTGTCCTGGCGTCTGGAGGAGGG - Intronic
1148828570 17:50413558-50413580 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
1154021027 18:10664021-10664043 CTTTGCTAAGAGCTGCAGGAGGG + Intergenic
1155512776 18:26594184-26594206 CTTCCCTAGCAGGAGGAGGAAGG - Intronic
1158103085 18:53853032-53853054 CTATCCTGGCAGCTGGGGGATGG - Intergenic
1158292493 18:55957089-55957111 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
1158532311 18:58274428-58274450 TTTTCCCGGAAGCTGGAGGAGGG + Intronic
1158964510 18:62611297-62611319 CTTTCCCAGCTGCTGGAGCCGGG - Intergenic
1159446053 18:68543024-68543046 CTTTCCTAGTTCCTGGAAGAAGG + Intergenic
1160960984 19:1720735-1720757 ATTTCCAGGCAGTTGGAGGAAGG - Intergenic
1161398976 19:4059281-4059303 CTTTCCTGGGGCCTGGAGGATGG + Intronic
1162757806 19:12870815-12870837 TTTTCCCAGCATGTGGAGGAAGG + Exonic
1162842874 19:13369158-13369180 CATCCATAGCAGCTGGAGGGCGG - Intronic
1163942813 19:20510739-20510761 ACTTACTAGCAGCTGAAGGAGGG - Intergenic
1164130344 19:22356061-22356083 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
1164216512 19:23155395-23155417 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
1164657045 19:29929638-29929660 CTATCCTAGCAGCTGTGAGATGG + Intronic
1165067821 19:33239313-33239335 CATTCCAAGCAGCTGGAACAGGG - Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165371577 19:35410620-35410642 CTTTACTAGCAGCGTGAGAATGG - Intergenic
1165973666 19:39655806-39655828 CTTTCCTTGCAGCATGAGAAAGG - Intergenic
1167756091 19:51414819-51414841 CTAACCTGGCAGCTGCAGGATGG + Exonic
1168630785 19:57954518-57954540 CTTTCCTGGGAGCCGGATGAGGG - Intergenic
926084013 2:10009901-10009923 CTTTCCAAGCAGGAGGAGGGAGG + Intergenic
926707889 2:15849501-15849523 CCTTCCTAGCAGCTGGGTGGGGG + Intergenic
927626817 2:24730255-24730277 CTTTCCTAGGAGAGGAAGGATGG - Intronic
927812133 2:26186105-26186127 CTTCCCAAGCAGCTGGGCGAGGG - Intronic
927846775 2:26476306-26476328 CTTCCCTGGCAGCTGGGGGTGGG + Exonic
928196392 2:29219485-29219507 CTTTCCTGGGAGCGGGAGGGTGG + Intronic
929123491 2:38502326-38502348 TTTTCTTTGAAGCTGGAGGAAGG - Intergenic
929387049 2:41421486-41421508 CTTTATTAGCAGCTTGAGAACGG + Intergenic
929666280 2:43836571-43836593 CGTTCTCAGCAGCTGGGGGATGG - Intronic
929760850 2:44805236-44805258 TTTCCCTAGCTGTTGGAGGAAGG + Intergenic
930038565 2:47103263-47103285 CTCTCGTAGCTGCTCGAGGAAGG - Intronic
931071217 2:58652437-58652459 CTCTTCTAGCAGCTGGGGGATGG + Intergenic
931116263 2:59170049-59170071 CTTTCTTACCAATTGGAGGAAGG + Intergenic
931122922 2:59240545-59240567 CTTTTCTAGAGGCAGGAGGATGG - Intergenic
933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG + Intronic
933307580 2:80620785-80620807 CTTACCTGGCAGCTGTATGAGGG - Intronic
934063377 2:88317783-88317805 CTTTTCCAGCATCTAGAGGATGG - Intergenic
935708006 2:105873017-105873039 CTTTCCTGGCAGCCGGGTGAGGG - Intronic
938146357 2:128838026-128838048 GTTTCCTAGGAGGTGGGGGAGGG - Intergenic
939533439 2:143393940-143393962 CATTCTTATGAGCTGGAGGATGG + Intronic
941078575 2:161034042-161034064 GCTTTCTTGCAGCTGGAGGATGG - Intergenic
943938999 2:193965662-193965684 CTTTACTAGCAGCATGAGAACGG + Intergenic
944729035 2:202499581-202499603 CTCTCGTAGCCGCTCGAGGAAGG - Intronic
945797909 2:214387583-214387605 CTTTATTAGCAGCGTGAGGATGG - Intronic
946225485 2:218262048-218262070 CCTTCCTGGGAGCTGGAGGGAGG - Exonic
946280360 2:218661767-218661789 CTAGCCTTGCAGCAGGAGGAAGG + Exonic
946442813 2:219711199-219711221 CTTTCCTAGCTTCTGGAAAAAGG + Intergenic
947026134 2:225740206-225740228 CTTTCCCAGCATATGGAAGAAGG - Intergenic
948056026 2:235009907-235009929 CTTTCCCAGGAGCAAGAGGAAGG - Intronic
948056213 2:235010890-235010912 CTCTCCTAGGAGAGGGAGGAAGG - Intronic
948442080 2:237999485-237999507 TTTTCCTAGAAGCTTTAGGATGG + Intronic
1169427895 20:5510532-5510554 CCTGCCTAGCAGCTGCAGGGAGG + Intergenic
1170047543 20:12101219-12101241 CTCTCATAGCAGCTGGGGAATGG + Intergenic
1170809008 20:19659045-19659067 CTTTCGTCTCTGCTGGAGGACGG + Intronic
1170812908 20:19688399-19688421 ATTCCTTAGCAGCTGGTGGAGGG - Intronic
1171308409 20:24125821-24125843 ACCTCCTGGCAGCTGGAGGATGG - Intergenic
1171482317 20:25463169-25463191 TTTTCCTAGGGGCTGGAGCAGGG - Intronic
1172340681 20:34155098-34155120 CTCTCATAGCCGCTTGAGGAAGG - Intergenic
1172716780 20:36970179-36970201 CTTTATTAGCAGCTTGAGAACGG - Intergenic
1172881187 20:38200967-38200989 CTATCCTAGCAGCTGCAGCCAGG + Intergenic
1173924435 20:46770342-46770364 CTTTATTAGCAGCATGAGGATGG - Intergenic
1173993015 20:47317445-47317467 ATTTCCTAGCCCCTGGAGAACGG - Intronic
1175620698 20:60444553-60444575 TTTTCATAGCAGCATGAGGATGG + Intergenic
1175777320 20:61661535-61661557 CTTTTTTAATAGCTGGAGGAAGG + Intronic
1176987035 21:15449103-15449125 CTTTATTAGCAGCTTGAGAATGG + Intergenic
1177017819 21:15814306-15814328 CTTTATTAGCAGCTTGAGAATGG + Intronic
1178045758 21:28692976-28692998 TTTTGCCAGCAGCTGGAGGAGGG + Intergenic
1178422965 21:32456824-32456846 CCTTCCCAGGACCTGGAGGAGGG + Intronic
1179468346 21:41593338-41593360 GTTGCCTAGCAACTGGAGAAGGG + Intergenic
1180758533 22:18180780-18180802 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180777492 22:18497823-18497845 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180810214 22:18755133-18755155 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181196356 22:21189385-21189407 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1181803902 22:25363798-25363820 CTTCCCTAGCAGCTGGTCCAGGG - Intronic
1181881964 22:25988386-25988408 CTTCCCTAGCAGATGGAGGATGG + Intronic
1182886777 22:33780455-33780477 CACTCCAGGCAGCTGGAGGATGG + Intronic
1203230442 22_KI270731v1_random:105456-105478 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1203276838 22_KI270734v1_random:93706-93728 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
949422273 3:3878522-3878544 CTTAGCTAGAAGCTGGGGGATGG + Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
949575412 3:5334008-5334030 CTTTCCTAGATATTGGAGGATGG - Intergenic
949598635 3:5574853-5574875 TGTCCCCAGCAGCTGGAGGATGG + Intergenic
950182909 3:10927629-10927651 CTTCCCTAGGACCTGGAGAAAGG + Intronic
950713323 3:14829361-14829383 CTTTGCTGGCAGGTGGAGAACGG + Intronic
950917644 3:16662321-16662343 CTTTATTAGCAGCTTGAGAAAGG + Intronic
951165668 3:19482793-19482815 ACTTGCTAGCAGCTGAAGGAGGG - Intronic
952169578 3:30792035-30792057 CTTTACTAGCAGCATGAGAACGG + Intronic
952326766 3:32327089-32327111 CTCTTCTAGCAGCTGAATGAGGG - Intronic
952453057 3:33449312-33449334 CTCTCGTAGCCGCTTGAGGAAGG - Intergenic
952790544 3:37197171-37197193 CATTCACAGCAGCTGGGGGATGG - Intergenic
953336447 3:42098360-42098382 CTTTTCCAGCACATGGAGGAAGG + Intronic
953345510 3:42172149-42172171 CCCTCCTAGGAGCTGGAGGAGGG - Intronic
953415374 3:42712609-42712631 CTTTCCCATCAGCAGCAGGAAGG - Intronic
953957507 3:47243234-47243256 CTTGCCAAGGAGCTGGAAGAAGG + Exonic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
957406610 3:79780106-79780128 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
958177995 3:90021606-90021628 CAATCCTAGCAGCTGGGGGATGG + Intergenic
958601413 3:96300453-96300475 CTCTCGTAGCCGCTCGAGGAAGG - Intergenic
959354168 3:105304375-105304397 CTTTCCCAGCTGCTGCTGGAAGG + Intergenic
960063715 3:113349194-113349216 CTCCCATAGCAGCTTGAGGAAGG - Intronic
961101958 3:124207259-124207281 CTTTCCTGGCAGGGGAAGGAGGG - Intronic
961925556 3:130475975-130475997 CTTTACCAACATCTGGAGGAAGG + Intronic
962066890 3:131991108-131991130 CTTTACTAGCAGTTTGAGAATGG + Intronic
962097759 3:132309521-132309543 ACTTGCTAGCAGCTGAAGGAAGG + Intergenic
962526273 3:136240590-136240612 TTTTCTAAGCAGCTGGAAGAGGG + Intergenic
962746644 3:138401992-138402014 CTGTCCTGGCCGCTGGAGGAGGG - Intronic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
964521995 3:157580090-157580112 ACTTGCTAGCAGCTGAAGGAGGG - Intronic
964538180 3:157748854-157748876 GTTTGCTAGGGGCTGGAGGAAGG - Intergenic
964924416 3:161938222-161938244 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
964932608 3:162045389-162045411 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
965555675 3:170015927-170015949 GTTTGCTAGCAGCTGGTGGGAGG - Intergenic
965566915 3:170129337-170129359 CATTACTGGGAGCTGGAGGAAGG + Exonic
966164885 3:177006330-177006352 CCTTTCTAGGGGCTGGAGGATGG - Intergenic
966887220 3:184383378-184383400 ATTTCCTAGCAGCGTGAGGCTGG - Exonic
967085983 3:186095834-186095856 CTTCCCCACCAGCTGGAGGCTGG + Intronic
969521009 4:7677826-7677848 GCTGCCTAGCAGGTGGAGGAGGG - Intronic
970142946 4:13002530-13002552 GTTTCCTAGGAGCTGGGGGCAGG - Intergenic
971252282 4:24983371-24983393 CTTTCCAAGCAGCAAAAGGAGGG - Intergenic
971281181 4:25243706-25243728 CTCTCGTAGCCGCTCGAGGAAGG + Intronic
971371822 4:26026033-26026055 CATTCCTAGCAGCAGGAAGGAGG - Intergenic
972077850 4:35108334-35108356 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
972340259 4:38146537-38146559 CTTCCCCAGGAGCTGGAGGAGGG - Intergenic
972419082 4:38869342-38869364 TTTGCCAGGCAGCTGGAGGAAGG + Intronic
972621376 4:40750606-40750628 CTTTCCTCGCATCTGCAGCATGG - Exonic
972786870 4:42334534-42334556 CTTTTCTCCCAGCTGGATGAAGG + Intergenic
972990833 4:44821182-44821204 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
974038245 4:56835964-56835986 CTTGCCTAGCAGATAGAGAAAGG + Intergenic
974093502 4:57336829-57336851 TTTTCAGAGCAGCAGGAGGATGG + Intergenic
974202762 4:58662728-58662750 CTTTTCTAGGCTCTGGAGGATGG + Intergenic
977043165 4:92039304-92039326 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
977753276 4:100634837-100634859 CTTCTCTAGATGCTGGAGGAGGG + Intronic
977972779 4:103230575-103230597 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
979252551 4:118580578-118580600 CTTTCCCAACAGCTGGATGAGGG + Intergenic
979551218 4:121993093-121993115 CTGTCCTGGCATCAGGAGGAGGG + Intergenic
980073403 4:128266810-128266832 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
980182039 4:129413353-129413375 CTTTCATAGCACCTCTAGGAAGG - Intergenic
980503059 4:133682058-133682080 TTCTCCTGGCAGATGGAGGATGG - Intergenic
984279942 4:177658292-177658314 CTTTATTAGCAGCACGAGGATGG + Intergenic
985685879 5:1281263-1281285 ATTTCCTTGCATCTGGGGGAGGG - Intronic
989095644 5:37778940-37778962 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
989328203 5:40224841-40224863 TTTTACTAGCAGCGTGAGGATGG - Intergenic
991510147 5:67367074-67367096 CTCTCATAGCACCTGGAGAAAGG - Intergenic
991675775 5:69088675-69088697 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
992325851 5:75658945-75658967 GGTTCCCAGGAGCTGGAGGAGGG - Intronic
993743277 5:91565160-91565182 CCTTTCTGGCATCTGGAGGATGG + Intergenic
993761463 5:91801505-91801527 CTTTACCAGCAGCTTGAGAATGG - Intergenic
993787110 5:92156235-92156257 TTTTCATAGCAGCGGGAGAATGG - Intergenic
994043742 5:95285141-95285163 CCCACCTAGGAGCTGGAGGATGG - Intergenic
998113155 5:139517587-139517609 TTTGCCCTGCAGCTGGAGGAAGG - Intergenic
998386032 5:141757673-141757695 CTTTTCTAGGAGCTGGAGCAGGG + Intergenic
999108044 5:149091213-149091235 CTATTCTAGGATCTGGAGGATGG - Intergenic
999517550 5:152316329-152316351 TATTCATAGCAGCTGGAGAATGG - Intergenic
1000639008 5:163678808-163678830 CTAGCCTAGCAGCAGGAGGTAGG + Intergenic
1000676941 5:164132685-164132707 CTATTCTAGGATCTGGAGGATGG - Intergenic
1000895037 5:166845277-166845299 CTTTCCTATCACTTGGAGGCGGG + Intergenic
1001395456 5:171416444-171416466 CATTCTTAGTAGCTGGAGTAAGG - Intergenic
1002998723 6:2311274-2311296 ACTTCCTAGCAGCTGAAGGAGGG - Intergenic
1003265166 6:4559503-4559525 CTTTGCTGGCAGCTCTAGGAAGG + Intergenic
1003281584 6:4697265-4697287 CTTTGTTAGCAGCTTGAGAATGG - Intergenic
1003440282 6:6134533-6134555 CTTTGCTAGCTGCTGGTGGGAGG - Intergenic
1004879977 6:19997796-19997818 GGTTACTAGCAGCTGGAGGAAGG + Intergenic
1005684209 6:28236336-28236358 CCTTCCTGGCAACTGGAGAATGG + Intergenic
1006155550 6:32011155-32011177 GTCTCCTACCAGCTGGCGGACGG - Intergenic
1006161882 6:32044009-32044031 GTCTCCTACCAGCTGGCGGACGG - Exonic
1006193245 6:32222208-32222230 ATTGCCTAGCAGCTAGAAGAGGG - Intronic
1007291026 6:40786888-40786910 CTTCCCTAGGAGATGAAGGAAGG - Intergenic
1007411452 6:41664473-41664495 CTTTCCCTGCAGCTGGATGCTGG - Intergenic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG + Intergenic
1010712913 6:79196100-79196122 CTTTATTAGCAGCAGGAGAATGG - Intergenic
1010730254 6:79383088-79383110 TATTCCCAGCAGCTGGGGGATGG + Intergenic
1011010334 6:82696261-82696283 CTTTCCTAGCATCTGATGAAAGG - Intergenic
1011700380 6:89949922-89949944 CTTTCAAAGCAGGTGTAGGAGGG + Intronic
1012146272 6:95686970-95686992 CTTTCCTAGCAGCTGGTCCTGGG + Intergenic
1012229784 6:96747393-96747415 CTTCCATATCATCTGGAGGAAGG - Intergenic
1013366896 6:109443658-109443680 GTGTCCTGGCGGCTGGAGGAGGG + Exonic
1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG + Intronic
1014139641 6:117926410-117926432 TTTTCGTAGCAGCATGAGGATGG + Intronic
1014546496 6:122742380-122742402 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
1016184042 6:141178844-141178866 CTTCCATAGCTGCTGGAGGAAGG - Intergenic
1016623012 6:146134400-146134422 CTTTACTAGCAGCATGAGAACGG - Intronic
1019170681 6:170131637-170131659 CTTCCCTTGTGGCTGGAGGATGG - Intergenic
1019294935 7:269063-269085 CCTTCCTGGCTGCTGGAGGACGG + Intergenic
1019730729 7:2627945-2627967 CCTTCCTGGCAGCTGGAGGGAGG + Intergenic
1019971964 7:4548652-4548674 CTTTCCCAGGAGCGAGAGGATGG - Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020690277 7:11346484-11346506 CTTTCTTACCAGCTGGGGCAAGG - Intergenic
1021341199 7:19464372-19464394 CTTTATTAGCAGCATGAGGACGG + Intergenic
1021849040 7:24790136-24790158 ACTTGCTAGCAGCTGGGGGAGGG - Intergenic
1022039066 7:26562812-26562834 CTTTACTTGCAGATGGAGGTTGG - Intergenic
1023855550 7:44181228-44181250 TTTGTCTAGCTGCTGGAGGAGGG + Intronic
1027854253 7:83488632-83488654 CTCTCCTAGCTTCTGGAAGAAGG - Intronic
1029900217 7:104031102-104031124 CTTTCTTAGCAGCATGAGAATGG + Intergenic
1029916848 7:104218941-104218963 CTCTCCTAGCTTCTGGTGGAGGG - Intergenic
1030729728 7:112972187-112972209 CTTTATTAGCAGCTTGAGAACGG + Intergenic
1033072872 7:138220871-138220893 CATTTCTGGCATCTGGAGGATGG - Intergenic
1033759242 7:144422244-144422266 CTCTCATAGCCGCTCGAGGAAGG + Intergenic
1036085861 8:5611974-5611996 CCTTCATGGCACCTGGAGGATGG - Intergenic
1036213690 8:6862821-6862843 ATTCTCTAGTAGCTGGAGGAAGG + Intergenic
1036771470 8:11581307-11581329 CTTTATTAGCAGCTTGAGAACGG - Intergenic
1036949754 8:13129939-13129961 CCTTCCTAGCAACAGGAAGACGG - Intronic
1037626296 8:20610155-20610177 CTTTCTTAGCAGCATGAGAATGG - Intergenic
1038296338 8:26293657-26293679 TTTTTCCAGGAGCTGGAGGAGGG + Exonic
1038439659 8:27562549-27562571 CTTGCCTAACAGCTGGTGCAAGG - Intergenic
1038638795 8:29307661-29307683 CTCTCATAGCTGCTCGAGGAAGG - Intergenic
1039418408 8:37415803-37415825 CTTTATTAGCAGCTTGAGAATGG - Intergenic
1039546410 8:38414191-38414213 CTTTTCAAGCTGCTGAAGGAGGG - Exonic
1039876608 8:41591842-41591864 ACTTGCTAGCAGCTGAAGGAAGG - Intronic
1041121392 8:54590035-54590057 CTTTCATAGAAGCAGAAGGAAGG - Intergenic
1041132571 8:54717124-54717146 TATTCCTAGAACCTGGAGGACGG - Intergenic
1041230163 8:55742222-55742244 GGTTGCTAGGAGCTGGAGGAAGG + Intronic
1042052890 8:64731131-64731153 CTTTATTAGCAGCGGGAGAATGG + Intronic
1042181025 8:66087918-66087940 CCTTTCTAGGATCTGGAGGATGG + Intronic
1042203715 8:66307125-66307147 CCTTCCTTGCAGCTGGTGAATGG + Intergenic
1042298037 8:67243249-67243271 CTTTATTAGCAGCTTGAGAATGG - Intronic
1042468103 8:69151811-69151833 TATTCCCAGAAGCTGGAGGATGG + Intergenic
1042497111 8:69467599-69467621 CTTTCCCTGCAGCTGCAAGAGGG - Intronic
1042768927 8:72357334-72357356 CTTTCCTTTAAGCTGGATGATGG - Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1043973961 8:86564345-86564367 CTTTACTAGCAGCATGAGAACGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1045680674 8:104656497-104656519 TTTTCCTAGGAGATGGAAGAGGG + Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047443015 8:124895741-124895763 TTTTCCTAACATTTGGAGGAAGG - Intergenic
1050958437 9:11694751-11694773 CTTTCCCCGCATGTGGAGGAAGG - Intergenic
1051508276 9:17848746-17848768 TTTTCCCAGGGGCTGGAGGAAGG - Intergenic
1053096916 9:35336626-35336648 CTTCCCAAGTAGCTGGTGGAAGG + Intronic
1053117124 9:35514847-35514869 CCTTCCTAGCAGCAGGATGGAGG + Intronic
1054152972 9:61620092-61620114 CTTTCCTTGCAGCACGAGGGTGG + Intergenic
1055591722 9:77822778-77822800 CTTTCCTAGAATCTTGGGGAAGG + Intronic
1055641043 9:78319345-78319367 CTGGGCTTGCAGCTGGAGGAGGG - Intronic
1055641713 9:78324056-78324078 CTTTCCAAGGTACTGGAGGAGGG - Intronic
1056874850 9:90318415-90318437 CCTTACTGGCTGCTGGAGGATGG + Intergenic
1057814664 9:98285701-98285723 CTTTCAGAGGAGCTGCAGGAAGG + Intergenic
1057971636 9:99564018-99564040 TTTTCCTGGAAGCTGCAGGAGGG + Intergenic
1058320306 9:103621998-103622020 CTTTACTAGCAGCATGAGAATGG - Intergenic
1059493917 9:114693837-114693859 CTTTGCTAGCATCTGATGGAAGG + Intergenic
1060543993 9:124450022-124450044 CCTTCCTCGCAGCAGGTGGAAGG + Intergenic
1060583697 9:124772527-124772549 CTTTCGTAGCAGGTGAGGGACGG - Intergenic
1060692498 9:125676594-125676616 AGTTGCTAGGAGCTGGAGGAAGG + Intronic
1060859814 9:126945122-126945144 CTTCCCTTGCAACTGGAGGAAGG - Intronic
1061781487 9:132999056-132999078 CCTTCTTAGCAGCTGGGGCAGGG + Intergenic
1186077001 X:5891529-5891551 GTTCCCTAGCAGCTGCGGGAGGG - Exonic
1186222312 X:7363151-7363173 CTTTGCCAGAAGCTGGAGGGAGG + Intergenic
1186624509 X:11278404-11278426 CTGGCCTTGAAGCTGGAGGAAGG + Intronic
1187029661 X:15472644-15472666 GGTTCCTAGGAGCTGGAGGAAGG + Intronic
1187480443 X:19650240-19650262 CTTTACTAGCAGCGTGAGAAAGG - Intronic
1187581306 X:20610267-20610289 CTTCCCAAGCAGCAGAAGGAAGG + Intergenic
1189251714 X:39605406-39605428 CATTTCCAGCAGCTGCAGGAGGG + Intergenic
1189612828 X:42754991-42755013 CATTCCTGGCAACTGGAGGAAGG + Intergenic
1189667514 X:43372772-43372794 CATTCATAGCAGCTGGAGAATGG - Intergenic
1190270682 X:48860909-48860931 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
1191849040 X:65572012-65572034 CTTTCCCAGCAAGGGGAGGAGGG - Intergenic
1192870011 X:75176071-75176093 CTCTCGTAGCCGCTCGAGGAAGG + Intergenic
1193043247 X:77025533-77025555 CTTTACTAGTAGCACGAGGATGG - Intergenic
1194142565 X:90223021-90223043 CTTTCCAAGCAGCTCCAGCAAGG - Intergenic
1196048245 X:111278680-111278702 CTTTGCTAGCAGGTGGTGGCTGG + Intergenic
1196459667 X:115917302-115917324 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
1196735426 X:118977305-118977327 CTTTCCTGGCCCCTGGGGGATGG - Intronic
1197171050 X:123434736-123434758 GATTCCTAGCTGCTGAAGGATGG - Intronic
1197602749 X:128548914-128548936 CCTTCCTAGCAGCGGCAGCATGG - Intergenic
1197995349 X:132366877-132366899 CTTTATTAGCAGCATGAGGATGG - Intergenic
1199666016 X:150097130-150097152 CTTGCCTTGAAGATGGAGGAAGG - Intergenic
1199851275 X:151726342-151726364 GCTTCCTGGCAGCTGGTGGAAGG + Intergenic
1199854810 X:151751676-151751698 CCTTCCTTGCTCCTGGAGGATGG + Intergenic
1200058559 X:153473986-153474008 CTATCCTTGCAGATGGGGGAAGG + Intronic
1200393684 X:155969815-155969837 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
1200488319 Y:3792122-3792144 CTTTCCAAGCAGCTCCAGCAAGG - Intergenic
1200694041 Y:6341207-6341229 GTTTGCTAGCAGCTGAGGGAAGG - Intergenic
1200908041 Y:8505616-8505638 GTTTGCTAGCAGCTGAGGGAAGG - Intergenic
1200952559 Y:8914412-8914434 GTTTGCTAGCAGCTGAGGGAAGG - Intergenic
1201041236 Y:9833512-9833534 GTTTGCTAGCAGCTGAGGGAAGG + Intergenic
1201270698 Y:12251086-12251108 ACTTGCTAGCAGCTGAAGGAGGG + Intergenic
1201496397 Y:14594718-14594740 CTCTCGTAGCCGCTCGAGGAAGG + Intronic
1201555734 Y:15263400-15263422 CTCTCATAGCCGCTTGAGGAAGG - Intergenic
1202099884 Y:21296083-21296105 CTTTCCTAGCAGTGTGAGAATGG - Intergenic
1202108568 Y:21397109-21397131 GTTTGCTAGCAGCTGAGGGAAGG + Intergenic
1202112105 Y:21432353-21432375 GTTTGCTAGCAGCTGAGGGAAGG + Intergenic
1202152131 Y:21853118-21853140 ACTTGCTAGCAGCTGAAGGAGGG - Intergenic
1202232078 Y:22668667-22668689 CTTTCCCAGCAGCAGGATAATGG - Intergenic
1202272057 Y:23082247-23082269 CTCTCGTAGCTGCTCGAGGAAGG + Intergenic
1202293969 Y:23338435-23338457 CTCTCGTAGCTGCTCGAGGAAGG - Intergenic
1202311078 Y:23527491-23527513 CTTTCCCAGCAGCAGGATAATGG + Intergenic
1202425054 Y:24715991-24716013 CTCTCGTAGCTGCTCGAGGAAGG + Intergenic
1202445735 Y:24954094-24954116 CTCTCGTAGCTGCTCGAGGAAGG - Intergenic
1202559724 Y:26143103-26143125 CTTTCCCAGCAGCAGGATAATGG - Intergenic