ID: 963794539

View in Genome Browser
Species Human (GRCh38)
Location 3:149618384-149618406
Sequence GCATCCATCTGTGCTGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963794537_963794539 11 Left 963794537 3:149618350-149618372 CCAAGCTTGAGGTAAGGAGAACA 0: 1
1: 0
2: 3
3: 11
4: 189
Right 963794539 3:149618384-149618406 GCATCCATCTGTGCTGGTCTTGG 0: 1
1: 0
2: 0
3: 21
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963794539 Original CRISPR GCATCCATCTGTGCTGGTCT TGG Intronic
900310369 1:2030496-2030518 TCCTTCATCTGTGCAGGTCTCGG - Exonic
900648456 1:3719468-3719490 GTCTCCATCTGTGCTGGTTGGGG - Intronic
900929096 1:5725127-5725149 GCCACCATCTGTGCTGCTCATGG - Intergenic
902692452 1:18118327-18118349 GCATCATTCTGGGCTGGGCTGGG + Intronic
902770282 1:18641821-18641843 GCAGCCATCTGCGCTGCTCTCGG + Intronic
904613561 1:31738123-31738145 GCAGCCATCAGTGATGGTGTTGG - Intronic
905166555 1:36086543-36086565 TCATCCAGCTGTGCTGCTCTTGG + Intronic
905245994 1:36614342-36614364 GCATGCATCTGTGAATGTCTGGG - Intergenic
906274867 1:44507993-44508015 GGAGCCATCTGTGCTGGGGTAGG + Intronic
907419989 1:54340789-54340811 GCAGCCCTCTGGGCTGGTATGGG - Intronic
909565797 1:77052304-77052326 GAATCCATCTGTGCTACTCCTGG - Intronic
911056975 1:93717259-93717281 GCCTCCTTCTGGGCTGGGCTGGG - Intronic
915898548 1:159829787-159829809 GCATGCATCTGAGCTGCTATAGG - Intronic
918272839 1:182919959-182919981 GCATGCATGTGTGCTGGTAGGGG - Intronic
919781051 1:201221495-201221517 GCATCACTCTGAGCTGGGCTGGG + Exonic
924929152 1:248712070-248712092 GCATTCATGGGTGCTGGTGTTGG - Intergenic
1063441613 10:6077680-6077702 GCCACCATCTTTGCTGGTCTTGG + Intergenic
1067371424 10:45687029-45687051 TCAACCTTCTGTGCTGGTCATGG + Intergenic
1067388359 10:45839121-45839143 TCAACCTTCTGTGCTGGTCATGG - Intronic
1067417710 10:46117837-46117859 TCAACCTTCTGTGCTGGTCATGG + Intergenic
1067445906 10:46345456-46345478 TCAACCTTCTGTGCTGGTCATGG + Intergenic
1067503122 10:46824724-46824746 TCAACCTTCTGTGCTGGTCATGG + Intergenic
1067591475 10:47515288-47515310 TCAACCTTCTGTGCTGGTCATGG - Intronic
1067638593 10:48023383-48023405 TCAACCTTCTGTGCTGGTCATGG - Intergenic
1067874897 10:49996944-49996966 TCAACCTTCTGTGCTGGTCATGG + Intronic
1070135191 10:73687804-73687826 TCAACCTTCTGTGCTGGTCATGG - Intronic
1077218511 11:1405036-1405058 GCCTCCATCTCTGGTGGTCTAGG + Intronic
1077466100 11:2734441-2734463 GCAGCCAGCTGTGCTGGGCAAGG + Intronic
1077490900 11:2860525-2860547 TCATCTATCTGTGCTGGGCTGGG - Intergenic
1080746506 11:35112787-35112809 TCAGCCAGGTGTGCTGGTCTTGG - Intergenic
1080851111 11:36070988-36071010 GCATCGATCTTTGCTGGAATTGG - Intronic
1081957757 11:47108329-47108351 GCAAACAGCTGTGCTGGTTTTGG - Intronic
1084805019 11:71572724-71572746 GCTTCCACCTGTGCTGTTCTGGG - Intergenic
1085217411 11:74844603-74844625 GCATTCAGCTGGGCTGTTCTGGG - Intronic
1085251621 11:75147781-75147803 GCATCCATCCTTGCTGCCCTTGG + Intronic
1089003138 11:115068678-115068700 GCATCCATCAGAGATGCTCTGGG - Intergenic
1091007114 11:131963251-131963273 GCCTCCATTTGCGCTGCTCTGGG - Intronic
1091674821 12:2481522-2481544 GCATCATTCAGTGCTGGGCTCGG - Intronic
1092256770 12:6930229-6930251 GCATCGTTATCTGCTGGTCTGGG + Intronic
1094772386 12:33678927-33678949 GAATCCAGCTGTGCTGTGCTTGG + Intergenic
1101764494 12:107685652-107685674 GAATCCACGTGGGCTGGTCTGGG - Intergenic
1105624241 13:22097899-22097921 GCATGCATCTCTGCCGGTCACGG - Intergenic
1106580159 13:31010828-31010850 TCATCCATCTGTGCTGTCCCTGG + Intergenic
1112228865 13:97568068-97568090 GCTTCCCTGTGGGCTGGTCTGGG - Intergenic
1112796128 13:103058407-103058429 ACATCCACCTGTGGTGTTCTAGG + Intronic
1118077068 14:62310849-62310871 GCATCCAACAGTGGTGGTCCTGG + Intergenic
1119898241 14:78238792-78238814 GTATCCCCCAGTGCTGGTCTGGG + Intergenic
1120313778 14:82865773-82865795 GCTTCCATCTTTGGTGCTCTTGG - Intergenic
1121862861 14:97336005-97336027 GCATCCTTCTGTCCTGGTCCTGG - Intergenic
1122457295 14:101864453-101864475 GCATCCACCCTTACTGGTCTGGG + Intronic
1122974500 14:105165550-105165572 TCATGGATCTGTGCTGGTCTCGG - Intronic
1123001044 14:105294232-105294254 GCAACCAACTGTGGTGGTCCTGG - Intronic
1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG + Intronic
1129111690 15:73340747-73340769 GCACCCACCTGTGCTGGCCTGGG - Intronic
1130381415 15:83375405-83375427 TTATTCATCTGGGCTGGTCTAGG + Intergenic
1132723758 16:1330045-1330067 GCATCCTTCTGTGCAGAGCTGGG - Intergenic
1132857595 16:2053810-2053832 CATTCCATCTGTGCTGGTCTTGG + Intronic
1133523152 16:6578409-6578431 TCATCCATCTGTCCTTGGCTGGG + Intronic
1138386954 16:56642471-56642493 GCAACCAGTTGGGCTGGTCTTGG - Intronic
1139476258 16:67203954-67203976 GCAGCAATCTCTGCTGGTCAGGG - Exonic
1140848966 16:78916622-78916644 CCATTCATCTTTGCTCGTCTAGG - Intronic
1143579651 17:7818111-7818133 GCATCCCACTTGGCTGGTCTTGG - Intronic
1148460893 17:47838450-47838472 GCTTCCATCTGTGCCCCTCTAGG - Exonic
1149604379 17:57914540-57914562 GCATCCATTTGGGAGGGTCTGGG + Intronic
1152031881 17:77847766-77847788 GCCTCCATCGTTCCTGGTCTGGG - Intergenic
1152890597 17:82879573-82879595 GGTTCCCTCTGTGCTGGTCCGGG + Intronic
1156535858 18:37863805-37863827 GCATCCATTTCTGCTTTTCTTGG - Intergenic
1157162296 18:45324990-45325012 GCACCCATCTTTGCTAGACTGGG - Intronic
1158808843 18:61007581-61007603 TCATCCATCTATGCTTGACTTGG - Intergenic
1159798629 18:72869903-72869925 GCCTCCAGCTCTGCTGGACTTGG - Intergenic
1160430859 18:78811731-78811753 GCATCCAGCTGTAAGGGTCTAGG - Intergenic
1162728119 19:12701893-12701915 GCATGCATCTGTGGAGGGCTGGG + Intronic
1164694919 19:30236184-30236206 GCTTGCTTCTGTGCTGGTCTTGG + Intronic
925601979 2:5617430-5617452 GCACACATCTGTGCTGGGCTTGG + Intergenic
925716236 2:6786640-6786662 GGAGTCATCTGTGCTGGTTTGGG - Intergenic
925909627 2:8565400-8565422 GCACCCATCTGTTCTGGGCAGGG - Intergenic
926386450 2:12340122-12340144 GAATCCATCTGTGGTGGGCCTGG + Intergenic
927122388 2:19978072-19978094 TCATCCATCTCTCCTGATCTAGG + Intronic
928468771 2:31552296-31552318 GCATTGATCTGTGCTGGCTTTGG - Intronic
929088218 2:38189610-38189632 GGAGCCAAATGTGCTGGTCTGGG + Intergenic
933284869 2:80375048-80375070 GCTTCCATCTGTGCTCGCCTGGG - Intronic
934984528 2:98874694-98874716 GGTTCCTTCTGTTCTGGTCTTGG + Intronic
946392627 2:219425812-219425834 CCACCCAGCTGTGCTGGTCTAGG + Intronic
948822218 2:240555825-240555847 CCATCCACCTGTGTTGGTCTGGG - Intronic
949007035 2:241655641-241655663 GCAGCCATCTGTGCGGGTGCCGG + Intronic
1168959838 20:1861432-1861454 GCATTCATTTTTCCTGGTCTGGG + Intergenic
1169755146 20:9035622-9035644 TCATCCTTCTGTTCTGCTCTAGG - Intergenic
1170353828 20:15470652-15470674 GCCTCCATCTGTGGTGGTCCAGG + Intronic
1171267174 20:23781305-23781327 GTATCCATCTGTATTGGACTTGG + Intergenic
1171784311 20:29448736-29448758 GCTTCCATCTGTGCTTGACACGG + Intergenic
1173757964 20:45534898-45534920 GCTTCCGTCTGACCTGGTCTGGG + Intronic
1174267632 20:49343511-49343533 GCACCTGTGTGTGCTGGTCTGGG + Intergenic
1174724578 20:52847971-52847993 GCAGCCATTTGAGCTGTTCTTGG + Intergenic
1175335495 20:58193295-58193317 GCATCCAGTTGGCCTGGTCTGGG + Intergenic
1180501823 22:15936659-15936681 TTATCAATGTGTGCTGGTCTTGG - Intergenic
1181628924 22:24140273-24140295 ACGTCCATCTGTGCTGCTGTGGG - Intronic
1182744533 22:32595376-32595398 GGATCCAGCTCTGCTGATCTTGG + Intronic
1183249902 22:36723026-36723048 GCCTCCAGCTGTCCTGGTCTGGG + Intergenic
1184078376 22:42199228-42199250 GGCACCATCTGTGCTGGTCAGGG - Intronic
1184365150 22:44046438-44046460 GGATGCATCTCTGCTGGGCTTGG + Intronic
1184959652 22:47919808-47919830 ACATCCATCAGTGCAGGTCTAGG - Intergenic
1185203480 22:49523010-49523032 GCCTTCAGCTGTGCTGGCCTGGG - Intronic
949970524 3:9398904-9398926 GCAGTCAGCTCTGCTGGTCTGGG + Intronic
950638062 3:14330105-14330127 GAATCCATCTGGGCTGGGCGTGG - Intergenic
952423095 3:33148792-33148814 GCATGGATCTGTGGTGGTCATGG + Intergenic
953183352 3:40616490-40616512 GCTTCCTTCTGTGCTCTTCTAGG + Intergenic
954004458 3:47579704-47579726 GCATCCATGTGTGCCCGGCTGGG - Exonic
955189020 3:56743168-56743190 TCCCCCATCTGTGCTGGACTGGG + Intronic
956986691 3:74709386-74709408 GCTTCCATGTGTGGTGGTTTAGG + Intergenic
962021525 3:131507246-131507268 TCATCAATCTTTGTTGGTCTGGG - Intergenic
962852736 3:139319890-139319912 GCGTCCCTCTGTGATGTTCTGGG + Intronic
963794539 3:149618384-149618406 GCATCCATCTGTGCTGGTCTTGG + Intronic
964273923 3:154987979-154988001 GCATGCCTCTGTGCTGGCCAAGG + Intergenic
964426935 3:156563501-156563523 GCATGCATCTGTGCATGTGTAGG - Intergenic
968986710 4:3879633-3879655 GGATTCATCTCTGCTGGTTTAGG - Intergenic
969462574 4:7336522-7336544 TCATCCATCTGTTCTGGGCACGG - Intronic
969462596 4:7336634-7336656 TCATCCATCTGTTCTGGGCACGG - Intronic
970601160 4:17642048-17642070 TCACCCACCTGCGCTGGTCTCGG + Exonic
973151779 4:46897362-46897384 GAATCCAGCTGAGCTGGTGTTGG - Intronic
974063677 4:57057438-57057460 GCAACCATCAGTTCTGGCCTTGG + Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
981037502 4:140187699-140187721 GCTTCCCTCTCTGCTGTTCTGGG + Intergenic
982034481 4:151332136-151332158 GCCACCACCTCTGCTGGTCTTGG + Intergenic
985767225 5:1786353-1786375 GCCTCTTTCTGTGCTGGTCCTGG - Intergenic
986287478 5:6370574-6370596 GCCTCCCTCTGTGCTGGTTCTGG - Intergenic
987696384 5:21338939-21338961 GCATACATTTTTGCTGTTCTAGG - Intergenic
988624703 5:32861175-32861197 GAATCCATCTGGTCTGGGCTGGG + Intergenic
988755817 5:34247607-34247629 GCATACATTTTTGCTGTTCTAGG + Intergenic
988854953 5:35219276-35219298 GAATCCATCTGTACAGCTCTGGG - Intronic
991744074 5:69713463-69713485 GCATACATTTTTGCTGTTCTAGG + Intergenic
991753633 5:69841773-69841795 GCATACATTTTTGCTGTTCTAGG - Intergenic
991795646 5:70293187-70293209 GCATACATTTTTGCTGTTCTAGG + Intergenic
991803250 5:70398500-70398522 GCATACATTTTTGCTGTTCTAGG - Intergenic
991823447 5:70588731-70588753 GCATACATTTTTGCTGTTCTAGG + Intergenic
991832951 5:70716898-70716920 GCATACATTTTTGCTGTTCTAGG - Intergenic
991888015 5:71292706-71292728 GCATACATTTTTGCTGTTCTAGG + Intergenic
995714018 5:115063963-115063985 TCACCGATCTGTGCTGGTCAAGG - Intergenic
997096923 5:130923822-130923844 GCATCCATCTCTGTAGGTCCAGG + Intergenic
997673410 5:135694875-135694897 TCATCCATCTGGGCTGGGCACGG - Intergenic
999366726 5:151028248-151028270 GCATCCATTTGTGCCAGGCTGGG - Exonic
1001257903 5:170199000-170199022 GCATACATGTGTGCAGGTTTTGG - Intergenic
1002668885 5:180848995-180849017 GGATCCTTTTGTGCTGGTCAAGG + Exonic
1002909287 6:1476733-1476755 GCATCCATGTGTGCAGGTTATGG + Intergenic
1002933686 6:1653073-1653095 GCATGCATCTGTGCTCCTCAAGG - Intronic
1005554463 6:26959419-26959441 GCATACATTTTTGCTGTTCTAGG + Intergenic
1006625149 6:35392515-35392537 TCATCCATCTGGACTGGCCTTGG - Intronic
1007760358 6:44129555-44129577 CCATCCATCTGTGGTAGCCTGGG - Intronic
1009798139 6:68498347-68498369 GTATACATCTGAGCTGGGCTTGG + Intergenic
1018391266 6:163343526-163343548 GCATCCATCAGGGGTGGCCTGGG + Intergenic
1018483396 6:164214686-164214708 GCTTCCACCTGTGCTCCTCTTGG + Intergenic
1018650655 6:165988875-165988897 GCTACCGTCCGTGCTGGTCTCGG - Intergenic
1018946728 6:168352482-168352504 TCATCCCTCAGTGCTGTTCTGGG - Intergenic
1020769536 7:12370824-12370846 GCATTTATCCGTGCTGATCTTGG - Exonic
1020840006 7:13204641-13204663 TCATCCTTCTGTGCTTGGCTTGG + Intergenic
1021542112 7:21771263-21771285 GTAGTCATCTTTGCTGGTCTTGG + Intronic
1023514240 7:40984636-40984658 CCTTCCATCTGTGATGTTCTAGG + Intergenic
1023898240 7:44452904-44452926 TCCTCCATCTTTGCTGTTCTGGG + Intronic
1028806482 7:95032211-95032233 GTATCCATCCGTGCTTCTCTTGG + Intronic
1033091399 7:138389560-138389582 GCATCAATCTGGGCTGGGCGTGG + Intergenic
1037987734 8:23300101-23300123 GCCTCCAGCTGTGCAGGCCTAGG + Intronic
1039421891 8:37450364-37450386 GCATCCACCTGGGCAGTTCTTGG - Intergenic
1040582033 8:48705943-48705965 GCATCCCTCTGCGGTGGTCCTGG - Intergenic
1040665735 8:49630434-49630456 GCAGCCATGTGTCTTGGTCTAGG - Intergenic
1041495257 8:58478964-58478986 GCACCCAGCTGAGCAGGTCTGGG + Intergenic
1044172051 8:89066064-89066086 GCATCCCACTGTGCTGCTCAAGG + Intergenic
1047436378 8:124838688-124838710 GCTTCCACCTGTGCTGGGCATGG + Intergenic
1048422412 8:134290555-134290577 CCTTCCATCTGTACTGTTCTGGG - Intergenic
1049240944 8:141537087-141537109 GCCTCCACCTGGGCTGGCCTGGG + Intergenic
1049542133 8:143213442-143213464 GCTTCCATCCATGCTGCTCTGGG - Intergenic
1059360007 9:113734847-113734869 GATTCCTTCTGTGTTGGTCTGGG + Intergenic
1060792393 9:126495295-126495317 GTGTCCAGCTGTGCTGCTCTGGG - Intronic
1061201017 9:129138604-129138626 GCAGACATCCGTGCTGGTGTCGG - Intronic
1061477763 9:130880443-130880465 GCAGCCATCAGTACTGGTGTTGG - Intronic
1062217690 9:135398264-135398286 GCAACCAACTGTCCTGGGCTGGG + Intergenic
1062716062 9:138010779-138010801 GCATGCACCTGTGCATGTCTAGG + Intronic
1203787480 EBV:136011-136033 GCCTCCATCTGCGGTGGTTTGGG - Intergenic
1185947945 X:4398727-4398749 GCTTCCATGGGTGCAGGTCTTGG + Intergenic
1187250793 X:17596387-17596409 GTATCCATCTGGGCATGTCTGGG - Intronic
1189254761 X:39629336-39629358 TCATCCATCTGTGCAGGACTGGG - Intergenic
1193246697 X:79238185-79238207 CCATACAACTGTGGTGGTCTTGG + Intergenic
1193494727 X:82197189-82197211 GCATGCATTTGTGCTGGTAGTGG + Intergenic
1194388962 X:93292717-93292739 GCAACTTTTTGTGCTGGTCTAGG + Intergenic
1196709267 X:118745568-118745590 CCATCCATATGTCCTGGTTTTGG + Intronic
1200236525 X:154470368-154470390 GCCTCCATCTGTCCTGCTCTGGG + Intronic
1201581437 Y:15514874-15514896 GCTTGCATCTGTGATGGTCTAGG - Intergenic
1201735326 Y:17254056-17254078 GCTTCCATTGGTGCAGGTCTTGG + Intergenic
1201747207 Y:17390049-17390071 GAATGCATCTGTGCTTCTCTGGG - Intergenic
1201933940 Y:19386117-19386139 GCACCCATCTTTGCTGTCCTCGG - Intergenic