ID: 963799107

View in Genome Browser
Species Human (GRCh38)
Location 3:149658884-149658906
Sequence GCTCCAGGCTCCCCGGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 255}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963799107_963799122 16 Left 963799107 3:149658884-149658906 CCGCCCTCCGGGGAGCCTGGAGC 0: 1
1: 0
2: 4
3: 20
4: 255
Right 963799122 3:149658923-149658945 CAGGTGGCTGGAAGTAGAGAGGG 0: 1
1: 0
2: 5
3: 66
4: 491
963799107_963799115 -3 Left 963799107 3:149658884-149658906 CCGCCCTCCGGGGAGCCTGGAGC 0: 1
1: 0
2: 4
3: 20
4: 255
Right 963799115 3:149658904-149658926 AGCCGGGATGGAACCCGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 86
963799107_963799121 15 Left 963799107 3:149658884-149658906 CCGCCCTCCGGGGAGCCTGGAGC 0: 1
1: 0
2: 4
3: 20
4: 255
Right 963799121 3:149658922-149658944 GCAGGTGGCTGGAAGTAGAGAGG 0: 1
1: 0
2: 3
3: 61
4: 528
963799107_963799118 4 Left 963799107 3:149658884-149658906 CCGCCCTCCGGGGAGCCTGGAGC 0: 1
1: 0
2: 4
3: 20
4: 255
Right 963799118 3:149658911-149658933 ATGGAACCCGAGCAGGTGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 144
963799107_963799117 0 Left 963799107 3:149658884-149658906 CCGCCCTCCGGGGAGCCTGGAGC 0: 1
1: 0
2: 4
3: 20
4: 255
Right 963799117 3:149658907-149658929 CGGGATGGAACCCGAGCAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963799107 Original CRISPR GCTCCAGGCTCCCCGGAGGG CGG (reversed) Intronic
900115152 1:1025120-1025142 GCTCCTGGCTCCTAGCAGGGAGG - Intronic
900165836 1:1243992-1244014 GCTGCAGGGTCCCCGCCGGGTGG - Exonic
900168534 1:1254793-1254815 GCTCCCGGCTCCTCAGCGGGTGG - Intronic
900988627 1:6087343-6087365 GCCCCAGGCTCCTGGGTGGGAGG + Intronic
901188561 1:7390148-7390170 TCTCCAGGGTCCTCAGAGGGTGG - Intronic
901212244 1:7533251-7533273 ACTCCAGGCTCCACTGAGGTAGG + Intronic
903229212 1:21911654-21911676 GCTCCAGGGCCCCCGTGGGGAGG + Intronic
904807285 1:33140892-33140914 GCTCCAGGTTCCCAGGGGGTAGG + Intergenic
905694630 1:39965575-39965597 GCTGGAGGGTCCCTGGAGGGTGG - Intronic
906291566 1:44622770-44622792 GCTCCAGGCACCCCAAAGGTAGG + Exonic
908497211 1:64706570-64706592 GCCCCAGCCTCCCCGAAGGCAGG - Intergenic
913703707 1:121397529-121397551 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
913980059 1:143499238-143499260 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
914074407 1:144324723-144324745 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
914104769 1:144641723-144641745 GCTCCAGGGTCCCGTGGGGGTGG - Intergenic
914492786 1:148162594-148162616 GCTCCTGGCTACCCGGTGGGCGG - Intergenic
915980342 1:160416239-160416261 GCTGGAGGCTCCACGGAGTGGGG + Intronic
917611405 1:176692534-176692556 TCTCCAGGCCTCCCTGAGGGGGG - Intronic
920649406 1:207825523-207825545 GTGCCAGGCTCCCAGCAGGGGGG + Intergenic
920761455 1:208787104-208787126 GAGCCTGTCTCCCCGGAGGGAGG + Intergenic
921934703 1:220786282-220786304 GCTCGAGGCTCCCCGCCGGTAGG + Intergenic
922503074 1:226110702-226110724 GCTCGGGGCTTCCCGGAGCGGGG + Intergenic
924502806 1:244653005-244653027 GCGCCAGGCGCCCCGGGGGCGGG - Exonic
1062820219 10:529084-529106 ACTCGAGGCTCCCAGGAGTGGGG + Intronic
1062971883 10:1654539-1654561 GCCCCAGCTTCCCCGCAGGGTGG + Intronic
1063362534 10:5469826-5469848 GCTCAAGGTTGCCCGGTGGGCGG + Intergenic
1065239899 10:23694846-23694868 TCTCGAGGCTCCCCCGCGGGCGG - Intronic
1070167783 10:73911375-73911397 GATCCAGGCTGCCCGGAGTCCGG + Exonic
1070587066 10:77774472-77774494 ACTCCAAGCTCCCCGGAGACAGG - Intergenic
1071601090 10:86959094-86959116 GCTCCAGGCTCAGGGGAGGCTGG - Intronic
1073206836 10:101774183-101774205 GCTCCCGGCTCCCTGTGGGGTGG - Intronic
1075829765 10:125398343-125398365 GCTCCAGGGTCCCAGGAGAATGG - Intergenic
1075851646 10:125593083-125593105 TCTCCATGCTCCACTGAGGGTGG + Intronic
1075885498 10:125896229-125896251 GCTCCCGATTCCCGGGAGGGCGG + Intronic
1076621582 10:131792454-131792476 GCTCCAGGCTGCCCCGGGGGAGG + Intergenic
1076680799 10:132170269-132170291 CCTCCAGGGTCCCCCGAGGGCGG + Intronic
1077107303 11:847820-847842 GCTCGAGGGTCCCAGGCGGGTGG - Intronic
1077126490 11:941003-941025 GCTCCGAGCTCCACGGAGTGTGG - Intronic
1077170871 11:1165175-1165197 GCTCCAGGGGCCCAGGACGGGGG - Intronic
1079130850 11:17746168-17746190 GCTCCAGGCTCAGGGGATGGAGG - Intronic
1080329201 11:31115887-31115909 GATGCAGGCTGCCCCGAGGGTGG + Intronic
1084710799 11:70842747-70842769 GCTGGAGGCTCCCAGGGGGGTGG + Intronic
1085477988 11:76799567-76799589 GCGCCAGGGTTCCTGGAGGGCGG - Intergenic
1085785107 11:79441419-79441441 TCTCCAGGCTCCCCGTAGCACGG + Intergenic
1089326440 11:117660650-117660672 GGTCCCGGCTCCCAGGATGGAGG - Intronic
1090517890 11:127448183-127448205 GCTCCAGGCAGGCCGGACGGAGG - Intergenic
1091563255 12:1630148-1630170 TCCCCAGGCTCCCCGGGAGGGGG - Intronic
1093745104 12:22731426-22731448 TCTCCAGGCTGACAGGAGGGAGG - Intergenic
1101194432 12:102368514-102368536 GCTCCAGGCTTCATGGAGGTAGG + Intergenic
1101876119 12:108597928-108597950 GCTCCAGGCTCTCAGGACAGAGG + Intronic
1102370840 12:112381739-112381761 GCGCCAGGCCCCGAGGAGGGAGG + Intronic
1102497618 12:113330312-113330334 CCTGCAGGCTCCCTGGATGGTGG + Intronic
1103595532 12:122022484-122022506 GCGCTCGGCTCCCGGGAGGGGGG + Intronic
1103724796 12:122992235-122992257 GTTCCAGGGTCCCCGGAGCAGGG - Intronic
1103901620 12:124306460-124306482 GCTCCAGGCTCCCCCGACACAGG - Intronic
1105454266 13:20525853-20525875 GCTCTGGGCTCCGGGGAGGGCGG + Exonic
1106319005 13:28620999-28621021 GCCCCAGGCTCCCAGGAGTCAGG - Intergenic
1107440480 13:40422984-40423006 GATGCAGACTCCCCAGAGGGAGG - Intergenic
1108591244 13:51914696-51914718 GATCCTGGCTCCTCGGAGTGTGG + Intergenic
1111738863 13:92176696-92176718 GCTCCAGGCACTCTGGAGGGAGG - Intronic
1113453847 13:110433229-110433251 GCTCCAGGCTGCCAGGCGGTGGG - Intronic
1113878835 13:113611186-113611208 GCTCCGGGAACCCAGGAGGGTGG + Intronic
1115399257 14:32939173-32939195 GCTCTGGGCTGCCCGGCGGGCGG - Intronic
1117353431 14:54902369-54902391 GCTCAAGACGCCCTGGAGGGCGG - Exonic
1118339198 14:64880156-64880178 GCCCCAGGCTCAGCGGCGGGCGG - Intergenic
1119520225 14:75279469-75279491 GCTCCAGGCTGCCGGGGGAGGGG - Intronic
1119687589 14:76645018-76645040 GCTCCATGCTCCCCTGGTGGGGG - Intergenic
1119706840 14:76788406-76788428 TCCCCAGGCTTCCCTGAGGGAGG - Exonic
1119841228 14:77794644-77794666 CCTCCTGGCTCCCCAGAGGCTGG - Intergenic
1120907975 14:89636974-89636996 GCTACAGGCTCTCAGGAGAGGGG + Intronic
1121982995 14:98471044-98471066 ACCCCAGGATCTCCGGAGGGAGG - Intergenic
1122705321 14:103617170-103617192 GCCCCAGGGTCCCGGCAGGGAGG - Intronic
1122961119 14:105093972-105093994 GCCCCAGGTTCCCGGCAGGGCGG + Intergenic
1123393383 15:19899779-19899801 GCTCCAGGGTCCCATGGGGGTGG + Intergenic
1124412054 15:29444836-29444858 GCTCCACAGTCCCTGGAGGGGGG + Intronic
1125721879 15:41849175-41849197 GCTTCAGGCTCTCCAGGGGGAGG - Intronic
1128365697 15:67000553-67000575 GCTCTTGGCTCCCAGGAGGAGGG - Intergenic
1129882794 15:79018216-79018238 GCCCAAGGCTCCCAGCAGGGTGG + Intronic
1129929662 15:79399869-79399891 GCTTCAGTCTCCACGGAGGCAGG + Intronic
1131172017 15:90185245-90185267 GCAACAGGCTCCCCGGGCGGCGG - Intronic
1131540058 15:93268342-93268364 TTTCCAGGCTCTGCGGAGGGCGG + Intergenic
1132585927 16:705727-705749 GCCTCAGCCTCCCCGGTGGGAGG - Exonic
1132588679 16:717003-717025 GCTCCAGGCTCCCCCCATGGCGG - Intronic
1132595686 16:748252-748274 GCCCCGGGCTCGCCGGTGGGTGG + Intronic
1132625761 16:890792-890814 GCTCCAAGCTCCAGGGAGAGTGG + Intronic
1132846229 16:2002080-2002102 GCTCCAGCCTGGCCGGAGGGTGG + Intronic
1132858861 16:2060201-2060223 GCTCACAGCTCCCTGGAGGGTGG + Intronic
1132956335 16:2596067-2596089 GCCCCAGGCTCCCAGGAGTGTGG - Intronic
1133055759 16:3144739-3144761 GCTCCGGGCTCCAGGGAGGCTGG - Exonic
1133220363 16:4316888-4316910 GGTCCATACTCGCCGGAGGGCGG + Intronic
1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG + Exonic
1135561887 16:23483055-23483077 GCTCCTGGGGCCCTGGAGGGGGG - Intronic
1136252026 16:29011632-29011654 GGTCCAGGCTGCCTGGAGGTTGG + Intergenic
1136699377 16:32117153-32117175 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
1136768270 16:32810781-32810803 GCTCCAGGGTCCCGTGGGGGTGG - Intergenic
1136799869 16:33060324-33060346 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
1136927680 16:34389270-34389292 GCTCCTGGCTCCGCGCAGGCAGG - Intergenic
1136957771 16:34804337-34804359 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
1136976894 16:35022536-35022558 GCTCCTGGCTCCGCGCAGGCAGG + Exonic
1137510634 16:49096817-49096839 GCGCCAGGTTCACTGGAGGGTGG - Intergenic
1137586829 16:49668754-49668776 GCACCAGGCCCCCAGGAGGAAGG + Intronic
1137789808 16:51165550-51165572 GCTCCTGGCTCTCAGGAAGGTGG - Intergenic
1139437285 16:66943555-66943577 TCTCCAGTCTACCTGGAGGGTGG + Intronic
1139778368 16:69330882-69330904 GGCCCAGCCTGCCCGGAGGGAGG - Exonic
1140899048 16:79351411-79351433 GCTCCAGGCTTGCGGGAGAGAGG + Intergenic
1141163878 16:81647656-81647678 GCTCCAGGCTCCCTGGAGGCTGG - Intronic
1141550958 16:84806477-84806499 ACTTCAGGCTCCCCTGATGGTGG + Intergenic
1141624723 16:85255113-85255135 GCTTCCGGCTCCCCGAGGGGCGG + Intergenic
1203070662 16_KI270728v1_random:1072797-1072819 GCTCCAGGGTCCCGTGGGGGTGG - Intergenic
1142607065 17:1087790-1087812 GCCCCTGGCTCCTGGGAGGGTGG - Intronic
1143109545 17:4545503-4545525 GCCGCAGGCTCCCGGCAGGGAGG + Intronic
1143719377 17:8799183-8799205 GCCCCAGGTACCCGGGAGGGAGG + Exonic
1144513820 17:15901078-15901100 GCTGCAGGCTCCCTCTAGGGAGG + Intergenic
1144840741 17:18184151-18184173 GCCCCGGGGCCCCCGGAGGGAGG - Intronic
1145007116 17:19344260-19344282 CCTCCAGCCTCCCTGGAAGGGGG + Intronic
1145889555 17:28405373-28405395 GCTCCAAGCTCCCAGCAGGGTGG + Exonic
1146123688 17:30216133-30216155 CCTCCAGGCTCCAGGGAGGGTGG + Exonic
1147155991 17:38544728-38544750 GCACCAGGCTCCCAGGAGAGTGG + Intronic
1147958474 17:44151305-44151327 GCTCCAGCTTCCCCTGGGGGAGG + Intronic
1151583327 17:74992518-74992540 GCTCCAGGCTCAGAGGAGAGAGG - Intronic
1152548929 17:81019666-81019688 GCTCCCGCCTCCCCGGAGTGGGG - Intergenic
1152739989 17:82014610-82014632 GCTCAAGACGCCCGGGAGGGAGG - Intronic
1152936544 17:83140458-83140480 GCTGGAGGCTCTCCTGAGGGTGG + Intergenic
1154518185 18:15197299-15197321 GCTCCAGGGTCCCGTGGGGGCGG - Intergenic
1156481130 18:37437107-37437129 GGGCCAGGCTCCCCAGTGGGTGG + Intronic
1157815586 18:50727573-50727595 CCTCCAGGCTCTCTGGAGGAAGG - Intronic
1160142476 18:76338037-76338059 GCTCAAGGCACCCCGGAGACAGG - Intergenic
1160169486 18:76541120-76541142 GTTCTTGGCTCCCCGTAGGGGGG - Intergenic
1160732863 19:649148-649170 GCTCCTGGGTCCCCTGACGGTGG + Intronic
1161027450 19:2043091-2043113 GCTCCAGGCTGTGAGGAGGGAGG - Intronic
1161401440 19:4067496-4067518 GCGCCAGGGACCCCGGGGGGTGG + Intergenic
1161663658 19:5562091-5562113 GATCTAGGCTCCCGGGAGGCAGG + Intergenic
1162066146 19:8126493-8126515 CCCCCAGGCTGCCCCGAGGGTGG + Exonic
1165145519 19:33727650-33727672 CCTCCAGGCCCCCCGGAAGGAGG + Intronic
1165491845 19:36128091-36128113 GCTCCGCGCTCCGCGAAGGGCGG + Intergenic
1166543788 19:43622617-43622639 CCTCCAGGCCCCCCGGGGAGGGG - Exonic
1166706209 19:44909295-44909317 GCTGCAGGCTGCGCGGAGGCAGG - Exonic
1166932467 19:46309267-46309289 GCTCCAGGCTGCCTGGGTGGGGG - Exonic
1202680086 1_KI270712v1_random:2232-2254 GCTCCAGGGTCCCGTGGGGGTGG - Intergenic
925235080 2:2271008-2271030 GCGGCATGCTCCCCGGAAGGAGG - Intronic
926136963 2:10343199-10343221 GGTCCAGGGTCCCAGGAGAGGGG - Intronic
927571883 2:24167200-24167222 GCTCCAGGCTCCAGCGTGGGTGG + Intronic
927971063 2:27306639-27306661 GCTCCACGCTACCCGCAGGGAGG - Intronic
928080763 2:28310339-28310361 TCTCCTGGCTCCCCTGGGGGAGG + Intronic
929545713 2:42854315-42854337 GCTCCAGGCTCCCCAGGATGAGG - Intergenic
929620047 2:43345565-43345587 GCTCCAGACTCCACGTCGGGTGG - Intronic
930946758 2:57084779-57084801 GCTCCCGGCACCCAAGAGGGAGG + Intergenic
932366501 2:71156571-71156593 GCTCCGAGCTCTCCAGAGGGGGG + Intergenic
933748687 2:85589233-85589255 GCTCCAGGGACCCTGGAAGGAGG - Intronic
936082900 2:109446920-109446942 GGTCCAGGGTCCCTGGAAGGGGG - Intronic
936449860 2:112625935-112625957 CCTCCAGGCTCCCCGGGGCATGG - Intergenic
936962353 2:118088780-118088802 GGTCGAGGCTCCCCGGACAGTGG + Intronic
937430230 2:121832038-121832060 CCTGCAGGCTCCACGGAGAGTGG + Intergenic
938518091 2:132037542-132037564 GCTCCAGGGTCCCTTGGGGGAGG - Intergenic
939455293 2:142426687-142426709 GCTCCAGACACCCAGTAGGGAGG - Intergenic
946747553 2:222861158-222861180 GCGCCAGGATCCCCGGGCGGCGG + Exonic
948425559 2:237884907-237884929 GCTCCAGGCCCCAGGGAGTGGGG + Intronic
948456383 2:238106448-238106470 GCTGCAGTCTCCACGAAGGGAGG - Intronic
948714815 2:239854217-239854239 AATCCAGGCTCCCATGAGGGTGG + Intergenic
949032452 2:241803445-241803467 GCTCGGGGCGCCCCGGAAGGCGG - Exonic
1168803996 20:662312-662334 ACTCCAGGCGGCCCGGAGAGAGG - Exonic
1168989169 20:2079594-2079616 CATCCAGGCTCCCAGGTGGGAGG - Intergenic
1170103556 20:12728703-12728725 GCTCAAGGCTCAAGGGAGGGAGG + Intergenic
1170652666 20:18257036-18257058 GCTCAAGGATCCCCTGAGGTTGG + Intergenic
1170898355 20:20436782-20436804 GCCCCAGGCTCCTGGAAGGGAGG + Intronic
1171186327 20:23126662-23126684 GCCCCAGGCTCCCGGGGGTGGGG - Intergenic
1171372486 20:24670606-24670628 GCCCAGGGCTCCCGGGAGGGGGG + Intergenic
1175125792 20:56750699-56750721 GGTGCAGGCTCCCGGGAGGCGGG + Intergenic
1175771988 20:61629798-61629820 GCTCCAGGCTGCAGGGAGGACGG - Intronic
1178841091 21:36137982-36138004 GCTACAGGCTTCCCGGAGCAGGG + Intronic
1179526077 21:41976717-41976739 CCCCCAGGCTCTCCGGGGGGAGG + Intergenic
1179541909 21:42088498-42088520 CCTGCAGCCTCCCCAGAGGGAGG - Intronic
1180157887 21:45986827-45986849 GCTCCAGGCTCCTCAGCAGGAGG - Intronic
1180559255 22:16602107-16602129 GCTCCAGGCTCCTCGGGGGGTGG - Intergenic
1180609047 22:17084242-17084264 GCTCCGGGCTCCAGGGAGGATGG - Intergenic
1181029826 22:20144324-20144346 GCTCCAGGCACCCGGCAGGTTGG + Intronic
1181042126 22:20197155-20197177 CTTCCAGACTCCCCTGAGGGAGG + Intergenic
1181339338 22:22165789-22165811 GCTCCTGGTGCCCTGGAGGGAGG + Intergenic
1181433295 22:22895709-22895731 GCTCCAGGCTCCCGTGGGTGGGG - Exonic
1181498659 22:23302755-23302777 GGTCCAGGCTCCCAGCTGGGGGG - Intronic
1181513445 22:23398995-23399017 GCTCCAGGCACCCAGCAGGTTGG - Intergenic
1182099292 22:27646433-27646455 GCTCCAGGGCCCCAGCAGGGAGG - Intergenic
1182520089 22:30880302-30880324 GCTCTGGGCTCCCAGGTGGGCGG - Intronic
1184049614 22:41994705-41994727 TGTCCACGCTCACCGGAGGGAGG - Exonic
1184089244 22:42283708-42283730 GCCCGAGGCTCCCCGGGGGCGGG - Intronic
1184194634 22:42918735-42918757 GCTCCAGCCTCCCTGGCAGGTGG - Intronic
950093181 3:10311887-10311909 GCTGCAGCCTCCCTAGAGGGTGG - Intronic
950185074 3:10939777-10939799 ACTCCAGGCCCCACGGAGAGAGG - Exonic
952425932 3:33174443-33174465 GCTCTGGGCTGCCCTGAGGGTGG - Intronic
952901067 3:38112056-38112078 ATTCCAGGCTCCCAGGAGGAGGG + Intronic
954266029 3:49470700-49470722 GCTCCACGTTCCCGGGAGCGCGG - Intronic
956084452 3:65595515-65595537 GCTCTAGTCTCCCCTGGGGGTGG + Intronic
961604461 3:128083428-128083450 GCTTCAGCCTTCCAGGAGGGAGG + Intronic
961668666 3:128510352-128510374 GCTGCAGGCTGGCGGGAGGGAGG + Intergenic
961749272 3:129085955-129085977 CCTCCTGGCTTCCCTGAGGGCGG + Intergenic
962259725 3:133895116-133895138 GCTGCAGGGGGCCCGGAGGGCGG - Intronic
963799107 3:149658884-149658906 GCTCCAGGCTCCCCGGAGGGCGG - Intronic
966355174 3:179071921-179071943 GCTCCCGCATCCCCGGCGGGCGG + Exonic
967837231 3:193974912-193974934 GCTCCTGTCTCCCCTGAGAGGGG + Intergenic
968266561 3:197367587-197367609 CCTCCAGGCTCCCAGGAGCTGGG - Intergenic
968562300 4:1290356-1290378 GCCCTGGGCTCCCGGGAGGGCGG - Intronic
968958720 4:3731939-3731961 GCTGCAGGCTCCCCAGGGGAAGG + Intergenic
969046666 4:4341371-4341393 GCTCAAGCCCCCCAGGAGGGAGG + Intergenic
969324240 4:6431698-6431720 TGTCCAGGCTCCCCAGAGGCAGG - Intronic
976053143 4:81031507-81031529 ACACCGGGCTCCCTGGAGGGAGG + Exonic
977582000 4:98735829-98735851 GCACCAGGCTTCCCTGAGGTGGG - Intergenic
982380077 4:154740640-154740662 GCTACAGTGTCCCCGCAGGGTGG - Intronic
986202605 5:5591741-5591763 GCCCCATGCACCCCGGAGTGAGG + Intergenic
986429008 5:7663422-7663444 GCTCCAGGCCCCCCCGTGGGAGG - Intronic
994043439 5:95284047-95284069 GCCCCAGCCTCCCCCGAGGGGGG - Exonic
997741451 5:136258520-136258542 GCTCCAGGCATCCCTGAGTGAGG - Intronic
997962351 5:138332047-138332069 GCGCCAGGCTCCCCGTGAGGCGG - Intronic
998188003 5:139997838-139997860 GTTCCAGGCTCCATGGAGAGGGG - Intronic
1001088693 5:168720933-168720955 GCTCCCGGGTCCCAGGAGGCTGG + Intronic
1001875092 5:175193227-175193249 GCCCCAGGCTCCACGGGTGGTGG + Intergenic
1002921299 6:1575250-1575272 GCTCCAGGCTCCTGTGTGGGTGG - Intergenic
1006813148 6:36833687-36833709 CCTCCAAGCTCACCGGTGGGTGG - Intronic
1007482553 6:42159602-42159624 GCTTCCGGCTCACTGGAGGGCGG - Intronic
1008592869 6:53011231-53011253 GGTCCAGCCTCCAGGGAGGGAGG - Intronic
1013462940 6:110392991-110393013 GTTGCAGGCTCCGTGGAGGGAGG + Exonic
1017811669 6:157988238-157988260 GCACGAGGCTCCCTGCAGGGGGG + Intronic
1018612984 6:165661913-165661935 GCTCCCCGTTCCCCGGAGGTGGG - Intronic
1019058547 6:169239954-169239976 GCTCCAAGCTTCCTGGAAGGAGG + Intronic
1019285976 7:223296-223318 GCTGCAGGCTCCACGGCGGGTGG + Intronic
1019486711 7:1292777-1292799 GCTGCAGGATCCAGGGAGGGAGG + Intergenic
1019517726 7:1447129-1447151 ACTCCAGGCTCCCGGGATGGTGG - Intronic
1019619066 7:1980670-1980692 GCTTCAGGCTTCCAGGAGAGAGG - Intronic
1020138290 7:5598665-5598687 GCTCCAGGTTCCCCAGAAAGAGG - Intronic
1022089555 7:27098487-27098509 GTTCCCGGCTCCCCGCAGGCCGG + Intergenic
1022898938 7:34782359-34782381 GCTCCAGCTTCCCTGGTGGGGGG + Intronic
1023354568 7:39354027-39354049 GCTCCAGGCGGCCCGGCAGGAGG + Intronic
1025481991 7:60993136-60993158 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
1025562116 7:62381228-62381250 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
1026009789 7:66628229-66628251 GCTCCCGGCTCCCTGGGAGGCGG - Intergenic
1026009959 7:66628945-66628967 GCTGCGGGCTGGCCGGAGGGGGG - Exonic
1026398316 7:69982448-69982470 GCTCCAGGCTATCCTGAGGGGGG + Intronic
1027202220 7:76071535-76071557 GCCCCAGGCTCCTCGAAGTGAGG - Intergenic
1027202518 7:76072683-76072705 GCCCCAGGCTCCTCGAAGTGAGG - Intergenic
1027202828 7:76073864-76073886 GCCCCAGGCTCCTCGAAGTGAGG - Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029128002 7:98308469-98308491 CCGCCAGGCTCCCAGGAGGAAGG + Intronic
1031129133 7:117810974-117810996 GTTCCAGGCTCGCAGGAAGGAGG - Exonic
1032081859 7:128863123-128863145 GCTGGAGGCTGCCCGGACGGGGG + Intronic
1034374314 7:150629180-150629202 GCTCCAGGCTGCTCAGATGGGGG - Intronic
1034491459 7:151395252-151395274 GCTCCAGGCGCCCTGCAGGCAGG + Intronic
1034617988 7:152435716-152435738 GCTCCAGGCTCCTCGGGGGGTGG + Exonic
1035290453 7:157834714-157834736 GCTCCAGGCTCACTGGAGGCTGG - Intronic
1037628474 8:20629693-20629715 GCTACAGGCTCCAGTGAGGGAGG - Intergenic
1037815183 8:22108271-22108293 GCTCCATTCTCCCCGCAGGCAGG + Exonic
1039875090 8:41578316-41578338 GCTCTCGGCTCCCCGGAGGTCGG - Intronic
1039907638 8:41798200-41798222 GCTCCAGCCTCCCCGGGGGGCGG - Intronic
1041016077 8:53594448-53594470 ACCCCAGGGTCCACGGAGGGTGG - Intergenic
1043873672 8:85463262-85463284 CCTCCAGGCTCGCCCGAGCGTGG + Intergenic
1044599705 8:93991548-93991570 GCTCCCGGCTCCCCGCGGCGGGG + Intergenic
1047732446 8:127737983-127738005 GCTCCGGGCTCCCGGGGGAGCGG + Intronic
1049004399 8:139845625-139845647 CCTCCATGCTCCCCGCAGTGTGG + Intronic
1049218716 8:141419166-141419188 GCTGCAGGCTACTGGGAGGGAGG - Intronic
1049225603 8:141449138-141449160 GCTCCTGGCTCCTGGGAGTGTGG + Intergenic
1049581452 8:143412962-143412984 GGACCAGGCTCACTGGAGGGTGG + Intergenic
1051345207 9:16145157-16145179 GCTTCAGGCTCCCTGGAGAAGGG + Intergenic
1052218658 9:25995522-25995544 CCTCTAGGCTCCTCGGGGGGCGG - Intergenic
1054798134 9:69321563-69321585 CCTCCAGGCTCCCAGGAGCCTGG - Intergenic
1055462214 9:76529785-76529807 GCTGCAGGCACCCAGGAAGGGGG - Intergenic
1057189705 9:93079839-93079861 GCTTCAGCTTCCCTGGAGGGTGG - Intronic
1057921912 9:99104910-99104932 GCCCCACGCTCCCCGGGGGCTGG - Intronic
1058852636 9:109027480-109027502 CCTCCTGGCTCCCAGGAGGCTGG + Intronic
1059130416 9:111742135-111742157 GCTCCAGGTTCCATTGAGGGAGG - Intronic
1059392210 9:114006350-114006372 GCTCAAGGCTGCCCGGTGTGGGG - Intronic
1060930466 9:127486526-127486548 AGTCCAGGCGCCCTGGAGGGTGG - Intronic
1061937475 9:133866142-133866164 GTTCCAGGCCCCCCAGGGGGTGG + Intronic
1062034481 9:134376826-134376848 GCTGCAGGGTCTCAGGAGGGAGG + Intronic
1062425046 9:136502230-136502252 GCTTCTGGGTCCCCGGTGGGAGG - Intronic
1062474279 9:136719724-136719746 GCTCCAGGGTCCCCCAGGGGTGG - Intronic
1062584263 9:137241854-137241876 GCCGCGGGGTCCCCGGAGGGCGG - Intronic
1189415325 X:40807605-40807627 GCTGCTGGCTTCCCTGAGGGTGG - Intergenic
1192176962 X:68892380-68892402 GCTCCAGCCTCCCCAGGGGCTGG + Intergenic
1193601289 X:83510468-83510490 GCTCCACACTTCCAGGAGGGAGG - Intergenic
1195295331 X:103470914-103470936 TCTCAAGGCTCAACGGAGGGAGG + Intergenic
1195755685 X:108196669-108196691 GCTCCACTCTCCCCTTAGGGAGG + Intronic
1197709300 X:129654467-129654489 GCGCCGGGCTCCCCGGGAGGCGG + Intronic