ID: 963799107

View in Genome Browser
Species Human (GRCh38)
Location 3:149658884-149658906
Sequence GCTCCAGGCTCCCCGGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 255}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963799107_963799122 16 Left 963799107 3:149658884-149658906 CCGCCCTCCGGGGAGCCTGGAGC 0: 1
1: 0
2: 4
3: 20
4: 255
Right 963799122 3:149658923-149658945 CAGGTGGCTGGAAGTAGAGAGGG 0: 1
1: 0
2: 5
3: 66
4: 491
963799107_963799115 -3 Left 963799107 3:149658884-149658906 CCGCCCTCCGGGGAGCCTGGAGC 0: 1
1: 0
2: 4
3: 20
4: 255
Right 963799115 3:149658904-149658926 AGCCGGGATGGAACCCGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 86
963799107_963799118 4 Left 963799107 3:149658884-149658906 CCGCCCTCCGGGGAGCCTGGAGC 0: 1
1: 0
2: 4
3: 20
4: 255
Right 963799118 3:149658911-149658933 ATGGAACCCGAGCAGGTGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 144
963799107_963799117 0 Left 963799107 3:149658884-149658906 CCGCCCTCCGGGGAGCCTGGAGC 0: 1
1: 0
2: 4
3: 20
4: 255
Right 963799117 3:149658907-149658929 CGGGATGGAACCCGAGCAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 95
963799107_963799121 15 Left 963799107 3:149658884-149658906 CCGCCCTCCGGGGAGCCTGGAGC 0: 1
1: 0
2: 4
3: 20
4: 255
Right 963799121 3:149658922-149658944 GCAGGTGGCTGGAAGTAGAGAGG 0: 1
1: 0
2: 3
3: 61
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963799107 Original CRISPR GCTCCAGGCTCCCCGGAGGG CGG (reversed) Intronic