ID: 963801708

View in Genome Browser
Species Human (GRCh38)
Location 3:149682915-149682937
Sequence CCAGAGCCACAGGAGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963801708_963801719 15 Left 963801708 3:149682915-149682937 CCTTGAACCTCCTGTGGCTCTGG 0: 1
1: 0
2: 0
3: 29
4: 254
Right 963801719 3:149682953-149682975 ACCCTGGGGGATGTGCAATAGGG 0: 1
1: 0
2: 2
3: 7
4: 86
963801708_963801715 0 Left 963801708 3:149682915-149682937 CCTTGAACCTCCTGTGGCTCTGG 0: 1
1: 0
2: 0
3: 29
4: 254
Right 963801715 3:149682938-149682960 CAGGATGAAGCATGGACCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 190
963801708_963801713 -8 Left 963801708 3:149682915-149682937 CCTTGAACCTCCTGTGGCTCTGG 0: 1
1: 0
2: 0
3: 29
4: 254
Right 963801713 3:149682930-149682952 GGCTCTGGCAGGATGAAGCATGG 0: 1
1: 0
2: 2
3: 32
4: 329
963801708_963801714 -1 Left 963801708 3:149682915-149682937 CCTTGAACCTCCTGTGGCTCTGG 0: 1
1: 0
2: 0
3: 29
4: 254
Right 963801714 3:149682937-149682959 GCAGGATGAAGCATGGACCCTGG 0: 1
1: 0
2: 0
3: 25
4: 293
963801708_963801716 1 Left 963801708 3:149682915-149682937 CCTTGAACCTCCTGTGGCTCTGG 0: 1
1: 0
2: 0
3: 29
4: 254
Right 963801716 3:149682939-149682961 AGGATGAAGCATGGACCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 215
963801708_963801718 14 Left 963801708 3:149682915-149682937 CCTTGAACCTCCTGTGGCTCTGG 0: 1
1: 0
2: 0
3: 29
4: 254
Right 963801718 3:149682952-149682974 GACCCTGGGGGATGTGCAATAGG 0: 1
1: 0
2: 0
3: 10
4: 123
963801708_963801717 2 Left 963801708 3:149682915-149682937 CCTTGAACCTCCTGTGGCTCTGG 0: 1
1: 0
2: 0
3: 29
4: 254
Right 963801717 3:149682940-149682962 GGATGAAGCATGGACCCTGGGGG 0: 1
1: 0
2: 3
3: 25
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963801708 Original CRISPR CCAGAGCCACAGGAGGTTCA AGG (reversed) Intronic
900576666 1:3385945-3385967 CCAGACCCACAGGCTGATCAGGG + Intronic
901228938 1:7631240-7631262 CCAGAGCAAAAGTAGGTCCAGGG - Intronic
902735654 1:18399073-18399095 CCAGGGACATAGGAGGATCAGGG + Intergenic
902735679 1:18399197-18399219 CCAGGAACACAGGAGGATCAGGG + Intergenic
903608373 1:24591699-24591721 GCAGAGCCACACGGGGTTCCTGG + Intronic
903739781 1:25552111-25552133 CCAGAGCCCCTGGAGGCCCAGGG + Intronic
904771559 1:32884159-32884181 CAACAGCCAAAGAAGGTTCAGGG - Intergenic
905319019 1:37102585-37102607 CCTGTGTCACAGGATGTTCAGGG - Intergenic
907291888 1:53419878-53419900 CCATAGGCACAGAAGGTACAGGG - Intergenic
908887360 1:68804854-68804876 TGAGAGCCACAGGAGGAACAGGG + Intergenic
912221406 1:107681372-107681394 CAATAGCCACATGAGGATCAAGG + Intronic
914461684 1:147891093-147891115 CCAGAGGCAGAGGAGGTTCTGGG - Intergenic
915072836 1:153286305-153286327 CCAGAGCCACAGGAAATGAAAGG + Intergenic
916792912 1:168139548-168139570 CCAGAGGCACATCAGTTTCAGGG - Intergenic
918125226 1:181577737-181577759 ACAGAGACACAGAAGGGTCAAGG - Intronic
918341701 1:183573140-183573162 CCCGGGCCACAGGAGACTCAGGG + Intronic
919263796 1:195236101-195236123 CCAGAGCAAAGGGAGGTTGAGGG + Intergenic
920970713 1:210741628-210741650 ATAGAGGCACAGGAGGTTAATGG + Intronic
921137187 1:212272300-212272322 CCACAGCCACAGCAGATACAAGG + Intergenic
922009006 1:221562636-221562658 TCAGAACCAAAAGAGGTTCAAGG + Intergenic
922473199 1:225889046-225889068 GCAGAGCCACAGGGGCTGCATGG + Exonic
922941195 1:229468100-229468122 CCAGAGCCCTGGGAGGTACAAGG + Intronic
924116700 1:240754215-240754237 TCAGAGCCAGAGGAGGTTGGTGG - Intergenic
1063028201 10:2204112-2204134 TCAGACCCACATGAGGTGCAAGG + Intergenic
1063306698 10:4909306-4909328 GTGGAGCCACAGGAAGTTCATGG + Intergenic
1064261579 10:13790622-13790644 CCAGAGCCACAGAAGCCACATGG + Intronic
1064935712 10:20677052-20677074 CCTGAGCCAGAGTAGGCTCAGGG + Intergenic
1068116859 10:52745608-52745630 CCAGAATCACAGCAGATTCAGGG - Intergenic
1069733721 10:70637300-70637322 CCTGAGCCCTAGGAGGTTGAGGG + Intergenic
1070207834 10:74281589-74281611 CCAGAGCTACAGCAGCTCCAGGG - Intronic
1070619218 10:77994418-77994440 ACAAAGCCACAGCAAGTTCATGG + Intronic
1073418701 10:103406207-103406229 CCAAAGCCACAGCACCTTCAGGG - Intronic
1073439448 10:103544027-103544049 CGGGAGCCACAGGAGGTAGAGGG + Intronic
1075123429 10:119681005-119681027 TCAGAGCCACAGGATGTGTAAGG - Intergenic
1075549484 10:123381650-123381672 TCAGGGCCACAGGAGGAGCAAGG + Intergenic
1075637960 10:124043170-124043192 CCAAAGTAACAAGAGGTTCAAGG + Intronic
1076207274 10:128613226-128613248 ACAGAGGCAGAGGAGGGTCAGGG - Intergenic
1076732800 10:132446818-132446840 CCAGAGCCACAGCAGGGGCCTGG + Intronic
1076744896 10:132507922-132507944 CTGGAGCCACAGCAGGGTCACGG + Intergenic
1076884213 10:133254277-133254299 CCAGAGCCTCAGGAGCCTCAGGG - Intergenic
1077252621 11:1567286-1567308 CCACAGCCACAGGAGGCACTGGG + Intronic
1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG + Intronic
1078398565 11:11002809-11002831 CCAGAGCCAAAGGAGGGGCAAGG - Intergenic
1078922539 11:15843822-15843844 CCAGAGGCGCCGGAGGCTCATGG + Intergenic
1079030065 11:16980044-16980066 CAACAGCCACAGGAAGTGCAAGG + Intronic
1079137999 11:17787210-17787232 CCAGAGCCACAGGGAAGTCAGGG + Intergenic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1084008302 11:66334597-66334619 CCCGAGCCCCAGGAGCTGCAGGG - Exonic
1084569262 11:69949686-69949708 CCAGAGGCAGAGTAGGGTCATGG - Intergenic
1084739537 11:71130352-71130374 CCAGGGTCACAGGAGCTTCTTGG + Intronic
1085392193 11:76188169-76188191 CCTGACCCACAGGAGGCACATGG - Intronic
1085886598 11:80530276-80530298 CCAGAGCCTGAAGAAGTTCACGG + Intergenic
1087165978 11:95002831-95002853 CCAGAGCCAAAACAGGTTCAGGG + Intergenic
1087479401 11:98680546-98680568 CAAGATGCACAGCAGGTTCAGGG - Intergenic
1089118905 11:116118170-116118192 CAAGAGCCACTGGATTTTCAAGG - Intergenic
1089316483 11:117594653-117594675 CCAAAGCCAGAGGAGGAGCAGGG - Intronic
1089654381 11:119936109-119936131 CCACACCCACAGGAGCTTCCTGG + Intergenic
1089727662 11:120496807-120496829 CCATAGCCACTGCAGGTTCTTGG - Intergenic
1090226143 11:125073290-125073312 CCAGAGCTCCAGGAGCTTCAGGG + Intronic
1090227577 11:125081011-125081033 CCAGGCCCACAGGAGGTGCTTGG + Intronic
1090664667 11:128906527-128906549 CCAGAACCACAGGAGCTTGAAGG - Intronic
1091549109 12:1524374-1524396 CCAGAGCCCCTGGCGGCTCAAGG - Intergenic
1092103633 12:5905218-5905240 CCAGAGCCCCAGGTGGCTCCAGG - Intronic
1095399051 12:41793512-41793534 CCAGAATCACAGCAGATTCACGG - Intergenic
1095599909 12:44002482-44002504 CCAGAGCCTGAGGAGGGACAAGG + Intronic
1096103783 12:48985178-48985200 CAGGAGCCACAGTAGGCTCAGGG + Intergenic
1100134857 12:91543363-91543385 CCAGAGCCACAGGAAGCCAAGGG + Intergenic
1101917911 12:108910510-108910532 CTACAGCCACACGTGGTTCAAGG + Intergenic
1102214809 12:111153078-111153100 CGAAAGCCACCCGAGGTTCAGGG + Intronic
1103038984 12:117679078-117679100 GCTGAGCCAGAGCAGGTTCAAGG - Intronic
1103793854 12:123490170-123490192 CCAGAGACACAGGAGAGGCAAGG - Intronic
1104980101 12:132569860-132569882 CCTGGGCCACAGGAGGGGCAGGG + Intronic
1106620827 13:31368803-31368825 CCAAAGCATCAGGAGGCTCAGGG + Intergenic
1108844656 13:54662840-54662862 TCAGAGGCACAGCAGGTTGAAGG + Intergenic
1112292590 13:98157956-98157978 TCCCAGCCACAGGAGGATCAAGG - Intronic
1113292840 13:108925106-108925128 CCAGAGCCAAGGGAAGTTGAAGG + Intronic
1113654750 13:112061138-112061160 CCTGAGCCACAGGCGGTTTCGGG - Intergenic
1113897559 13:113775786-113775808 TCAGGGCCACAGGAGCTTCAGGG - Intronic
1116202266 14:41813348-41813370 CCAGGGCCACAGGGGGTTGGGGG - Intronic
1117108719 14:52426304-52426326 CCTGAGGCACAAGCGGTTCATGG + Intergenic
1118029930 14:61809796-61809818 CCAGAGCAACAGGAAAGTCAAGG + Intergenic
1118367287 14:65106686-65106708 CCAAAGCCTCAGGAGGTAGAGGG - Intergenic
1118891694 14:69915318-69915340 CCACAGTGACAGGAGGTTCAGGG - Intronic
1120467301 14:84875305-84875327 GCAGAGGAACAGAAGGTTCAGGG + Intergenic
1120732517 14:88019566-88019588 CCTGAGCCAGAGTAGGCTCAGGG - Intergenic
1120732635 14:88020692-88020714 CCTGAGCCACAGTAGGCTCAGGG - Intergenic
1121123157 14:91389051-91389073 CCAGCCCAACATGAGGTTCAAGG + Intronic
1122207570 14:100155642-100155664 CCAGAGCCACAAGGGGATCCTGG - Intronic
1122409084 14:101516989-101517011 CCAGAGCCGCAGCAGGGGCAGGG - Intergenic
1122615449 14:103014660-103014682 CAAGAGCCACAGAAGGTTCCAGG + Intronic
1122829405 14:104388439-104388461 CCAGAGCCGGTGGCGGTTCAGGG - Intergenic
1202931067 14_KI270725v1_random:31899-31921 CCAGAGCCACAGCAGGCCAAAGG - Intergenic
1124003871 15:25780830-25780852 CCACAGTCACAGGCGGGTCATGG + Intronic
1125587502 15:40831280-40831302 CAAGAGCCACAGGATGGGCACGG + Intergenic
1126087454 15:45023265-45023287 CCAGAGCCAAAAGAGCTCCATGG + Exonic
1126360954 15:47845462-47845484 CCAGAGCCACAAGAGCTAGAGGG + Intergenic
1126498564 15:49319731-49319753 CCAGAGCCACATGAGCTGCCGGG + Exonic
1127632318 15:60838585-60838607 CAGAAGCCACAGTAGGTTCATGG + Intronic
1128990904 15:72259686-72259708 CCAGCTTCATAGGAGGTTCACGG - Intronic
1129239427 15:74242750-74242772 CCTGAGCCACAGCAGCCTCATGG + Intronic
1131574469 15:93572661-93572683 CCAGAGCCAGAGGAGAAACAGGG - Intergenic
1132670143 16:1099132-1099154 CCTGAGCCACGGGAGGCTCCTGG - Intergenic
1133723608 16:8517501-8517523 CCAGAGCCAAGGGAGGATCTTGG - Intergenic
1134510626 16:14844074-14844096 CCAGGGCCACAGGGGCCTCATGG - Intronic
1134698264 16:16242560-16242582 CCAGGGCCACAGGGGCCTCATGG - Intronic
1134973572 16:18552117-18552139 CCAGGGCCACAGGGGCCTCATGG + Intronic
1136088454 16:27902150-27902172 CCAGAGCCAGATGTGGTTCCCGG - Intronic
1136637227 16:31532170-31532192 TCAGATTCACAGCAGGTTCAAGG - Intergenic
1136669847 16:31846408-31846430 TCAGATTCACAGTAGGTTCAAGG + Intergenic
1137553008 16:49453252-49453274 CCAGACCCACAGCAACTTCAAGG + Intergenic
1139262352 16:65606853-65606875 CCACAGTCACATGAAGTTCATGG + Intergenic
1141484396 16:84329252-84329274 CCAGAGACAAAGAAGGGTCAGGG - Intronic
1142860307 17:2756741-2756763 CCAGAGCCACGGGAGGTGCTGGG - Intergenic
1143712582 17:8744666-8744688 GCAGAGCCACAGGTGGCTCAGGG + Exonic
1144367412 17:14557621-14557643 TCAGAGCCAGAGTAGGCTCAGGG + Intergenic
1144807229 17:17976113-17976135 GCAGAAGGACAGGAGGTTCAGGG + Intronic
1146705042 17:34995150-34995172 TCAGAGCCTCAGGGGGTTCAGGG + Intronic
1146786874 17:35728776-35728798 CCAGACCCACCTGAGGCTCAAGG + Intronic
1147238079 17:39072204-39072226 GAAGAACCACAGGAGGTTCAGGG + Intronic
1147561203 17:41510377-41510399 CCTGAGACACAGGAGGTGCTGGG + Intergenic
1148196960 17:45720782-45720804 CCACAGCCACACGAAGTTCTAGG + Intergenic
1151377072 17:73697197-73697219 AGAGAGCCACAGGAGCCTCAGGG - Intergenic
1152112856 17:78366637-78366659 CCAGAGCCCCAGGAGAGTCAGGG - Intergenic
1152262767 17:79275835-79275857 CCAGAGCCACCGGAGGACCCAGG + Intronic
1152779360 17:82219517-82219539 CCAGAGACACAGCAGGCCCAGGG - Intergenic
1152860908 17:82696907-82696929 CCACAGCCACACGTGGCTCATGG + Intronic
1153112632 18:1610432-1610454 CCAGAATCACAGCAGATTCACGG + Intergenic
1153184260 18:2469410-2469432 CCAAAACCAGAGGTGGTTCAAGG + Intergenic
1157398825 18:47368814-47368836 CCAGAACCCCATGAGATTCATGG + Intergenic
1160193782 18:76736581-76736603 ACTGAGCCTCAAGAGGTTCAGGG - Intergenic
1160548196 18:79675971-79675993 CCAGAACAAAAGGAGGTTAAGGG - Intergenic
1161596238 19:5152422-5152444 CCTGAGCCATAGGAGGTGCAGGG - Exonic
1162473719 19:10887546-10887568 CCAGAGACACAGGATGTCCTGGG - Intronic
1163758688 19:19121370-19121392 CCAGAGCCACAGGATGAACAGGG + Exonic
1164074520 19:21801753-21801775 CCAGCTGCTCAGGAGGTTCAGGG - Intergenic
1165595682 19:37009839-37009861 CCAGTGGAAGAGGAGGTTCAGGG - Intronic
1166389140 19:42399332-42399354 CCAGAGCCACTGCAGGGTCATGG - Intergenic
925338294 2:3114818-3114840 CCAGGGCCACAGAGGGATCAAGG - Intergenic
925560972 2:5195091-5195113 CCAGAATCACAGCAGATTCACGG + Intergenic
927604666 2:24476058-24476080 CCAGACCCAAAGAAGCTTCAAGG - Intergenic
928106747 2:28475440-28475462 CCAGAGCTGAAGGAGGCTCATGG - Intronic
928913525 2:36447197-36447219 CAAGAGACAGAGCAGGTTCAAGG + Intronic
932141973 2:69287055-69287077 CCAGAGGCACAGAGGGTTCCTGG + Intergenic
932404993 2:71506848-71506870 CCAGAGCCTCTGGAGCTGCAGGG + Intronic
935184705 2:100721688-100721710 TCAGAACCAGAGGAGGTTCTGGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937228552 2:120383778-120383800 CCAGGGCCACAGGAGATGAATGG - Intergenic
937753922 2:125513331-125513353 CCAGACACCCAGGAGATTCAGGG + Intergenic
938137779 2:128773657-128773679 GCAGGGCCAGAGCAGGTTCAGGG - Intergenic
938292031 2:130155536-130155558 CCAGAGCCTGAGGGGGCTCAGGG + Intronic
939562909 2:143752759-143752781 CCAGACCCACAGGAAGCTCTGGG + Intronic
940009427 2:149038655-149038677 CCCGCGCCCCAGGTGGTTCAGGG + Exonic
944779295 2:203001593-203001615 ACATAGCCACATGAGGTTAATGG - Intronic
946399661 2:219461685-219461707 CCAGTGGCAGAGGAGGTTCCAGG + Intronic
948426212 2:237888036-237888058 CCAGAACCACAGAATGTTCATGG - Intronic
948895829 2:240926432-240926454 CCAAGGCCACAGCAGCTTCAGGG - Intronic
1168875107 20:1166049-1166071 CAAGAACCACACAAGGTTCAAGG - Exonic
1169835190 20:9870069-9870091 ACAGGGCCACATGGGGTTCAGGG + Intergenic
1170768954 20:19315537-19315559 CCATAGCCCAGGGAGGTTCAGGG - Intronic
1171344095 20:24452629-24452651 CCAGAGCCACAGGTGGCACCGGG + Intergenic
1173495506 20:43514831-43514853 CCTGAGCCCCAGAAGGTTCGGGG + Intronic
1173558341 20:43983730-43983752 CCTGAGCCTAAGGAGGTGCAGGG - Intronic
1174460327 20:50678008-50678030 ACGGAGCCACAGGAGTTACAAGG + Intronic
1176218380 20:63958739-63958761 CCAAAGTCACAGCAGGTTGATGG - Exonic
1176593090 21:8660521-8660543 CCAGAGCCACAGCAGGCCAAAGG - Intergenic
1179722907 21:43325497-43325519 CCAGGGCCACATGTGGTGCAAGG - Intergenic
1179949750 21:44703043-44703065 CCATAGCCACAGGAGGTCCCTGG + Intronic
1180275937 22:10637648-10637670 CCAGAGCCACAGCAGGCCAAAGG - Intergenic
1181180492 22:21064551-21064573 CCTGAGCCTGAGGAGGTTCAAGG + Intergenic
1182668460 22:31975867-31975889 CAAAAGCCACATGTGGTTCATGG - Intergenic
1183650265 22:39149602-39149624 CCTGGACCACAGGAGGGTCAAGG - Intronic
1183672378 22:39280506-39280528 CCAGCTGCACCGGAGGTTCAGGG - Intergenic
1184154462 22:42658043-42658065 CTAGAGGCTCAGGAGTTTCAAGG - Intergenic
1185249513 22:49792861-49792883 CAGGAGCCACAAGAAGTTCAGGG + Intronic
949412292 3:3779074-3779096 CAGGAGCCACAGGAAGTTCAGGG - Intronic
951031320 3:17885039-17885061 CCAGAGCCACATGATATTCCTGG + Intronic
954435315 3:50492801-50492823 CCCTAGCCACAGGACCTTCAGGG - Intronic
954627104 3:52028611-52028633 GCAGAGGGACAGGAGGTTCTAGG - Intergenic
954934356 3:54313187-54313209 CCTGAGGCTCAGGAGGTTAATGG + Intronic
955460795 3:59180786-59180808 CCTGAGCCCAGGGAGGTTCAGGG + Intergenic
956686190 3:71830381-71830403 CCAGAGACAGAGGGGGTTCCTGG + Intergenic
959158808 3:102698501-102698523 GCAGAGCGACAGGCGGTTCTAGG + Intergenic
960310689 3:116112883-116112905 TCAGAGCCACAGAATTTTCAGGG - Intronic
961381521 3:126498966-126498988 CCAGGGCCACAGCAGGTGCTGGG + Intronic
961749424 3:129086630-129086652 CCAGAACCACAGGACAGTCAGGG + Intergenic
961779490 3:129313421-129313443 CCAGATCCCCAGGTGGTTCTGGG - Intergenic
962391853 3:134978780-134978802 CCAGAGCCACAGGAGCAACCTGG - Intronic
963801708 3:149682915-149682937 CCAGAGCCACAGGAGGTTCAAGG - Intronic
964474900 3:157089356-157089378 ACAGAGCCACAGAATGTTAAAGG + Intergenic
964530048 3:157657694-157657716 TCAAAGCCAGAAGAGGTTCAGGG + Intronic
964868599 3:161289026-161289048 CCAGAGGCTCAGGTGGTTCCAGG + Intergenic
966177864 3:177158614-177158636 CCATAGCAACAGGATTTTCAGGG - Intronic
966932353 3:184684121-184684143 TCAGAGCCAGGGGAGTTTCAGGG + Intronic
967979896 3:195059441-195059463 GCAGAGCCACAGGAGGGTCTGGG + Intergenic
968466562 4:754479-754501 CCAGAGCCCCTGGAGGTAGAAGG + Intronic
968837722 4:2977684-2977706 CGAGATCCACAGGAGGATCTTGG - Intronic
968848206 4:3059348-3059370 CCAGAATCACAGCAGATTCAGGG - Intergenic
969759888 4:9174146-9174168 CCAGAGCCAAAGGAGCTCCTGGG - Intronic
971588220 4:28432571-28432593 CCAGGCCCACTGAAGGTTCATGG + Intergenic
971744341 4:30559656-30559678 CCTGAGCCAGAGTAGGTTCAGGG - Intergenic
973738168 4:53892780-53892802 CCAGTCCCTCAGGAGGTTCAGGG + Intronic
976060332 4:81120312-81120334 CCAGAATCACAGCAGATTCAGGG - Intronic
980717314 4:136643602-136643624 CAAGAGCCACTAGAGCTTCAGGG - Intergenic
987414321 5:17647357-17647379 CCCTATCCACAGGATGTTCAAGG + Intergenic
988485321 5:31663818-31663840 CCAAAGCCACAAACGGTTCAGGG - Intronic
991457671 5:66822083-66822105 CCAGAGCTCAAGGAAGTTCAGGG + Intronic
995180293 5:109224561-109224583 CCTGACCCAAAGGAGGTACAAGG - Intergenic
995211466 5:109544564-109544586 CCAGATACTCAGGAGGTTAAGGG - Intergenic
996067852 5:119099750-119099772 CCAGAGCTTTAGGAGGGTCAAGG + Intronic
996909609 5:128640102-128640124 CCAGAGCCACATGAAAATCAAGG + Intronic
998136923 5:139678818-139678840 CCAGAGCAGCTGGAGGCTCAAGG - Intronic
998138292 5:139685862-139685884 CCAAAGACACAGGAGCGTCAGGG - Intergenic
998944867 5:147327668-147327690 CCATAGCTCCAGGAGGTTTATGG + Intronic
1000422256 5:161052103-161052125 ACTGAGGCACAAGAGGTTCATGG - Intergenic
1001592779 5:172877856-172877878 CGTGACCCACAGGAGATTCAAGG + Intronic
1001892636 5:175351967-175351989 ACAGGGGCTCAGGAGGTTCAGGG + Intergenic
1002302152 5:178263261-178263283 CCCGGGCCCCAGGAGGTCCAGGG + Exonic
1002449329 5:179310041-179310063 GCAGATCCACAGGACATTCAGGG - Intronic
1002757386 6:174914-174936 CGAGAGCCATTGTAGGTTCATGG - Intergenic
1003191537 6:3879429-3879451 CGGGAGCCACAGCAGGGTCAGGG + Intergenic
1004177994 6:13357250-13357272 CTTGAGCCACAGGAGGTAGAGGG + Intergenic
1004426512 6:15510603-15510625 CAAGACACACAGGAGGATCAAGG - Intronic
1005856976 6:29870111-29870133 CCAGAGCCTCAGGAACTTGATGG + Intergenic
1006150299 6:31983467-31983489 CCAGAGGCTCAGGAGGCTGAGGG - Intronic
1006156600 6:32016205-32016227 CCAGAGGCTCAGGAGGCTGAGGG - Intronic
1006343006 6:33457186-33457208 CCAGAGGCACAGGCTGTTGAGGG - Exonic
1007183585 6:39948752-39948774 TCAGAGCCACAGGAGCTTGCTGG + Intergenic
1007328185 6:41079957-41079979 CCAGAGCCACAGCAGCTGTATGG - Intronic
1007340476 6:41188234-41188256 CCAGATCCACAGCAGATCCACGG - Intergenic
1007577125 6:42932456-42932478 CCAGACTCACAGGAGATTCACGG - Intronic
1008630475 6:53359320-53359342 CCTGAGCCACAGGCAGTTAACGG - Intergenic
1011499184 6:87969018-87969040 CAACAGTCATAGGAGGTTCACGG - Intergenic
1013375172 6:109508041-109508063 CCAGAATCACAGCAGATTCATGG - Intronic
1016766991 6:147806080-147806102 GAAGAGCCACAGGAAGTGCATGG + Intergenic
1017196221 6:151703421-151703443 CCTAAGCCAGAGGAGTTTCACGG - Intronic
1018842100 6:167524670-167524692 CGAGAGACACAGGAAGCTCAGGG - Intergenic
1019426160 7:977822-977844 CCAGAGCCACAGGCCAATCAAGG - Intergenic
1019427969 7:986316-986338 CATGACTCACAGGAGGTTCAAGG + Intronic
1019920551 7:4160763-4160785 CTGGAACCACAGGAGGTTAAGGG + Intronic
1020409025 7:7869862-7869884 CCAGAGCAACAGAAGGTTAGTGG - Intronic
1020748747 7:12112119-12112141 CCAGAGCCCTAGCAGGTTCTAGG + Intergenic
1023042370 7:36182974-36182996 CCAGAGCTACAGGGTGTGCATGG - Intronic
1023234318 7:38067887-38067909 CCTGAGCCACAGGAAGACCAAGG - Intergenic
1026069489 7:67105306-67105328 ACTGAGCCCCAGTAGGTTCAAGG - Intronic
1026707418 7:72707007-72707029 ACTGAGCCCCAGTAGGTTCAAGG + Intronic
1030118458 7:106082501-106082523 CCAGAATCACAGCAGATTCACGG + Intergenic
1031305504 7:120121007-120121029 CCAGAATCACAGCAGATTCACGG - Intergenic
1034966586 7:155395133-155395155 GCAGAGCCAGAGGAGGCACAGGG + Exonic
1035304957 7:157926117-157926139 CCACAGCCACAGGAAGCTGAGGG + Intronic
1035304967 7:157926177-157926199 CCACAGCCACAGGAAGCTGAGGG + Intronic
1035304976 7:157926237-157926259 CCAGAGCCACAGTATGCTGAGGG + Intronic
1035371145 7:158379711-158379733 GTAGACCCACAAGAGGTTCATGG + Intronic
1036592032 8:10177188-10177210 TCCAAGTCACAGGAGGTTCAAGG - Intronic
1037228263 8:16622053-16622075 TCAGAACCAGGGGAGGTTCAGGG - Intergenic
1037844766 8:22273251-22273273 CCAGAGCCACAGCAAGATTAAGG - Intergenic
1038764435 8:30414290-30414312 CCACAGATACAGGAGGTCCAAGG - Intronic
1040388859 8:46932939-46932961 CCAGAGCCCCAGGTGTTGCAAGG + Intergenic
1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG + Intergenic
1041091939 8:54310150-54310172 CCAGACCCACAGGTGGTTTAAGG + Intergenic
1043496622 8:80808060-80808082 TCAGAGGTACAGGAGGTTCCTGG + Intronic
1044307656 8:90656737-90656759 CAAGAGACACAGAGGGTTCATGG - Intronic
1044884292 8:96760172-96760194 CCAGAGCCATAGGAGTCACAAGG - Intronic
1048019053 8:130521492-130521514 CCAGAGCCACAGGAGGGAAGTGG + Intergenic
1049247189 8:141569133-141569155 CCAGAGCCCCAGGAGTGTGAGGG - Intergenic
1049327361 8:142029869-142029891 CCAGAGCCAGAGGAGGACCCCGG - Intergenic
1049353271 8:142175520-142175542 CCAGAGCCAGAGCAGGTGCAGGG - Intergenic
1049512648 8:143037359-143037381 ACAGAGACTCAGGAGGTTCGGGG - Intergenic
1049522648 8:143102130-143102152 CCAGAGGCACAGCAAGTTTATGG + Intergenic
1051193201 9:14535762-14535784 CCAGAGCCTGGGGAGGTGCAGGG - Intergenic
1052972678 9:34386630-34386652 CCAGAGCCACAGCAGAATCAGGG - Intronic
1054959651 9:70953795-70953817 CAAGAGCCAAAGCAGGTTGACGG + Intronic
1057213843 9:93217632-93217654 TCAGGGCCACAGGAGGACCATGG - Intronic
1057819823 9:98322222-98322244 CCAGAGGAACAGCAGGTTTAAGG - Intronic
1058909145 9:109505218-109505240 CCAGAGATTCAGAAGGTTCATGG - Intergenic
1062229847 9:135475860-135475882 CCAGAGGTGCAGGAGGTTCCAGG + Intergenic
1062656520 9:137606637-137606659 CCACAGCCTCAGGCGGTGCAGGG - Intronic
1203623133 Un_KI270749v1:139328-139350 CCAGAGCCACAGCAGGCCAAAGG - Intergenic
1190910047 X:54762813-54762835 CTAGGCCCATAGGAGGTTCAGGG + Intronic
1196303541 X:114073329-114073351 CCAGTGCCCCAGGAGAATCAAGG + Intergenic
1197022318 X:121706165-121706187 CCAGAGCCACAGGGAGTTGCTGG + Intergenic
1197704064 X:129621381-129621403 CCATAGCCACATGTGGCTCATGG + Intergenic
1199897167 X:152136778-152136800 CCAGAGTGACAGTAGGGTCATGG + Intronic
1200293265 X:154891997-154892019 CCTCAGGCAAAGGAGGTTCAGGG + Intronic
1201521341 Y:14877358-14877380 CCAGATACTCAGGAGGTTGAGGG + Intergenic