ID: 963806090

View in Genome Browser
Species Human (GRCh38)
Location 3:149724485-149724507
Sequence TTTTTTTTAAGGAGTCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 444}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963806090_963806097 7 Left 963806090 3:149724485-149724507 CCCCCCAGACTCCTTAAAAAAAA 0: 1
1: 0
2: 4
3: 36
4: 444
Right 963806097 3:149724515-149724537 CAGTTTTTAATCCTTTCCAATGG 0: 1
1: 0
2: 5
3: 17
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963806090 Original CRISPR TTTTTTTTAAGGAGTCTGGG GGG (reversed) Intronic
901934421 1:12617845-12617867 TTTTTTTTCTGGAGACGGGGTGG - Intergenic
903805185 1:26000123-26000145 TTTTTTTTAGGGGGGCGGGGGGG + Intergenic
904246272 1:29190333-29190355 TTTTTGAGACGGAGTCTGGGTGG - Intergenic
904787116 1:32991537-32991559 TTTTTGAGATGGAGTCTGGGAGG - Intergenic
906014468 1:42562426-42562448 TTTTGTTTAAGGTGTCAGGAAGG - Intronic
906251496 1:44314136-44314158 TTTTTTTTAAAGTGTGTTGGGGG + Intronic
907142055 1:52196283-52196305 GTTCTTTTAAGGAGTCTTGATGG + Intronic
909796139 1:79738277-79738299 TTCTTTTCAAGGTGTGTGGGAGG + Intergenic
910432386 1:87171947-87171969 TTTTTTTTTAAGAGGGTGGGTGG - Intergenic
911167033 1:94733479-94733501 TGTTTTTTATGGAGCCTGGATGG + Intergenic
911361773 1:96885502-96885524 TTTTTTTAGAGCAGTCTTGGAGG - Intergenic
911569544 1:99506643-99506665 TTTTTTTTTTGGAGGTTGGGGGG - Intergenic
912532087 1:110332561-110332583 TTTTTTTTTAAGAGACAGGGAGG + Intergenic
912766574 1:112417816-112417838 TTTTATTTATGGAGTTTTGGGGG + Intronic
914146734 1:145001863-145001885 TTTTTTTTAAGTTAGCTGGGGGG + Intronic
914264111 1:146022906-146022928 TCTTTTTTAAGGGGGGTGGGGGG - Intergenic
916826771 1:168449459-168449481 TTTCCTTTCAGGACTCTGGGAGG + Intergenic
917955389 1:180091188-180091210 TTTTTTTTTAAGAGACGGGGGGG + Intronic
918933954 1:190895836-190895858 ATTGTTTTAAGTAGTCTGAGTGG - Intergenic
918958947 1:191245884-191245906 TTTTGTGTAAGGAGTAAGGGAGG + Intergenic
919225273 1:194690490-194690512 TATTTTTTATGGAGCCGGGGCGG + Intergenic
919437266 1:197577381-197577403 CATTTTTTAAAGAGTATGGGGGG - Intronic
920281166 1:204844805-204844827 GAGTTTTTAAGGATTCTGGGTGG + Intronic
921860097 1:220033887-220033909 TTTTTTTACAGGAGTGTGGCGGG + Intronic
922059278 1:222072208-222072230 CTTTTTTTGGGGGGTCTGGGGGG - Intergenic
923331758 1:232931753-232931775 TTCTTTTGAAGGAGGCTAGGAGG - Intergenic
923859763 1:237881821-237881843 TTTTTTTTAAAGGGGGTGGGTGG - Intronic
924026814 1:239842220-239842242 TTTTTTTTGAGGGGGTTGGGGGG + Intronic
924865708 1:247977939-247977961 ACGTTTTTAAGGAGTCTGGACGG - Intronic
1063134537 10:3205259-3205281 TTTTTTCTAAGGCGTTTGTGTGG - Intergenic
1063535015 10:6875043-6875065 TTTATGTTAAGGAGAATGGGTGG + Intergenic
1065300084 10:24313214-24313236 TGATTTTTAGGGAGCCTGGGTGG + Intronic
1065491015 10:26281415-26281437 TTTTTTTTCTGGAATCTGAGAGG + Intronic
1067401608 10:45979626-45979648 TTTTTTTTAAGCATTATGGTTGG + Intronic
1068777775 10:60886701-60886723 TTTTTTTTAAGAGATGTGGGGGG + Intronic
1069309464 10:67016387-67016409 TTTTATTTAAGGAGTTTGCATGG + Intronic
1069427094 10:68298071-68298093 TATTTTTTATTGAGACTGGGGGG - Intronic
1069952328 10:72027636-72027658 TTTTTTTCAATTAGGCTGGGAGG - Intergenic
1070484300 10:76914800-76914822 TTTGTTTTGAGGGGGCTGGGAGG - Intronic
1072113046 10:92341957-92341979 TTTTTTCTAAGGATGGTGGGAGG + Intronic
1073534378 10:104262398-104262420 TTTCTTTAAAGGAGACTGAGTGG - Intronic
1073604839 10:104883781-104883803 TTTCCTCTAAGGAGGCTGGGAGG + Intronic
1074279404 10:112036746-112036768 TGTTCTTTAAGAAGCCTGGGAGG - Intergenic
1075148149 10:119901030-119901052 TTTTTTTTAAAGAGTGGGGGGGG + Intronic
1075869766 10:125762474-125762496 TTTTTTTAAATGAGTCCAGGTGG - Intronic
1075934255 10:126326211-126326233 TTTTTTTTAAGAAATCTGCATGG + Intronic
1078409960 11:11106426-11106448 ATTTTTTTAAGAAGGCAGGGTGG - Intergenic
1078835199 11:15021262-15021284 TTTTGTTTAAGGAGTAAGGAAGG - Intronic
1079704913 11:23602761-23602783 TTTTTTTTTTGAAGTCTGGTAGG - Intergenic
1080262786 11:30367881-30367903 TTTTTTGTAAGAATTCTGAGAGG - Intergenic
1080939610 11:36900726-36900748 TTTTTTTTCTGGAGGCTGTGGGG + Intergenic
1081140672 11:39494768-39494790 TGTGTTTTAAGGAGTCCAGGAGG + Intergenic
1081193746 11:40136209-40136231 TTTTTTTTTAGGAGACCAGGTGG - Intronic
1081341524 11:41933700-41933722 CTTTTTTTAAGGGGTAAGGGAGG - Intergenic
1081828291 11:46080447-46080469 TTCTTTTTAAGAAGTTAGGGCGG - Intronic
1082667405 11:55990839-55990861 TTTTGTATAAGGTGTATGGGAGG - Intergenic
1082910793 11:58372044-58372066 TTTTGTATAAGGTGTATGGGAGG - Intergenic
1083013529 11:59427081-59427103 TTTTTTTTAATGAGGCTGGATGG + Intergenic
1083170474 11:60921418-60921440 TCTTTTTTAGGGGGTCTGGGTGG - Intronic
1083918828 11:65768955-65768977 TTTTTTTAAAAGAGTCTTTGAGG + Intergenic
1084173948 11:67413804-67413826 TTTTTTTTAAAGAGATAGGGGGG + Intronic
1084590312 11:70086417-70086439 TTTGTTTGAAGGACTCTAGGGGG - Intronic
1085871214 11:80351520-80351542 TTTTTTTTGTAGAGACTGGGGGG + Intergenic
1086069662 11:82786819-82786841 TTTTTTGAAAGGAGTATGAGAGG - Intergenic
1086318248 11:85615903-85615925 TTTTTTTTTAGGGGGGTGGGTGG - Intronic
1087452535 11:98343293-98343315 TTTTTTATAAGGTGTAAGGGAGG + Intergenic
1088209991 11:107444105-107444127 TTTTTTTTAAGGAGGGAAGGGGG + Intronic
1090040256 11:123284468-123284490 TTTCTTTTCAGGAATGTGGGAGG - Intergenic
1090146405 11:124327855-124327877 GTTTCTTTAAGGATTCAGGGTGG - Intergenic
1090255021 11:125277918-125277940 TTTTTTTTAAAGAGACTAGCTGG + Intronic
1091246501 11:134100154-134100176 TTTTTTTTAAGGAGGAAAGGGGG - Intronic
1091736779 12:2929059-2929081 TTTTTTTTTAAGAGTTCGGGTGG + Intronic
1091822935 12:3490385-3490407 CTTTTTTAAGGGAGTTTGGGCGG - Intronic
1091929411 12:4382805-4382827 TTATTTTTAAGGAGGATGGGAGG + Intergenic
1092038282 12:5360698-5360720 AGTTTGTTAAGGAGGCTGGGGGG + Intergenic
1092809049 12:12254957-12254979 GTTTTTTTAAGGAATCTGATTGG - Intronic
1093119407 12:15250094-15250116 TTTTTTTTGAAGAGTTTGAGAGG - Intronic
1094115100 12:26902781-26902803 TTTTTTTTAAGGTGTAAGGAAGG - Intergenic
1094186187 12:27645441-27645463 TTTTTTTAAAAAAGTGTGGGGGG + Intronic
1095312257 12:40713590-40713612 TGTTTTTTATGGTGTGTGGGGGG - Intronic
1095603428 12:44039750-44039772 TTCTTTTTAAATAGTCTGGATGG - Intronic
1096354917 12:50932540-50932562 TTTTTCTTAATGTCTCTGGGAGG + Intergenic
1096534171 12:52260273-52260295 TTTTTTTTAAGGATTCAGGGTGG + Intronic
1096997246 12:55846298-55846320 TTTTTTGTAGAGAGTGTGGGGGG + Intergenic
1097380758 12:58893268-58893290 GTATTTTTAAGGACTGTGGGTGG + Intronic
1097857061 12:64474708-64474730 TTTTTTTTCAGTTGTATGGGAGG - Intronic
1098762348 12:74440567-74440589 TTTTTTTTAATGTGTCTGTCTGG - Intergenic
1099423833 12:82498833-82498855 TTTTTTTTTTTTAGTCTGGGAGG - Intergenic
1100265479 12:92971879-92971901 TTTTTTCTTATGAGTCTGTGTGG - Intergenic
1100313562 12:93421200-93421222 TTTTTTTTGGGGGGGCTGGGGGG + Intronic
1100742698 12:97612011-97612033 TTTTTATTAAAGACTCTGTGGGG - Intergenic
1101092951 12:101306328-101306350 TTTTTTTTAAGTCTTCTAGGTGG + Intronic
1101241330 12:102842600-102842622 TTCTTTGTGAGGGGTCTGGGGGG + Intronic
1102376893 12:112429498-112429520 TTTTTTTTTAAGAGACAGGGTGG + Intronic
1102652217 12:114449935-114449957 TTTATTTTAAGGAAACTGGTAGG - Intergenic
1102886474 12:116525810-116525832 TGTTTCTTTAGGAGACTGGGCGG + Intergenic
1103185972 12:118957706-118957728 TTTCTTATAAGCAGTATGGGGGG - Intergenic
1103731942 12:123033571-123033593 TTTTTTGCAAGCAGTCAGGGTGG + Intronic
1104108257 12:125683741-125683763 TTTTTTTAAGGCAGTTTGGGAGG - Intergenic
1104223161 12:126805829-126805851 TTTTTTAGATGGAGTCTGGCTGG + Intergenic
1106270204 13:28145649-28145671 TTTTTTTTAAGGAGACGAGCTGG + Intronic
1106305304 13:28504268-28504290 TTTTATTTGAGGAGCCAGGGTGG - Intergenic
1106366297 13:29084349-29084371 TTTTTTTTAAGGAGGGTGGAGGG - Intronic
1107110649 13:36693964-36693986 TGTGTTTTAAGGAGTGTGGAGGG - Intronic
1107788382 13:43976889-43976911 GTTTTTTTCAGGAGACTGGAGGG - Intergenic
1107794365 13:44034696-44034718 TTTTTCTTAAGGGGTCAGTGCGG + Intergenic
1108222806 13:48254579-48254601 TTTTTTTTTAGGAGTTTTGAAGG + Intronic
1109056933 13:57562760-57562782 TTATTTTCATGGAGTCTGTGTGG - Intergenic
1109139302 13:58693919-58693941 TTTTTTTTAAGTAGTTTTAGTGG - Intergenic
1110068948 13:71148415-71148437 TTTTTCTTAAGGAGTTGGGATGG + Intergenic
1110953991 13:81529855-81529877 TTTTTTTTAAGGTGGTTTGGTGG - Intergenic
1111879926 13:93943605-93943627 TTTTTTTGAAAGAGACTGTGAGG - Intronic
1112549280 13:100404478-100404500 TTTTTTCAAAGGAGTCCTGGGGG + Intronic
1113821164 13:113214505-113214527 TTTTTTTTAAAGGGCCTGAGAGG - Intronic
1114928193 14:27431901-27431923 CTTTTTTTAAGGAGACCTGGAGG - Intergenic
1115594326 14:34894515-34894537 TTCTTTTTAAAAAGCCTGGGTGG + Intergenic
1115693383 14:35870066-35870088 TTTTTTTTAAAGAGGTGGGGTGG + Intronic
1116189577 14:41646980-41647002 TTGTTTTCCAGGAGTCTGTGAGG + Intronic
1117194425 14:53325364-53325386 TCTTTTTTCAGGAGGCTTGGTGG + Intergenic
1117199419 14:53373097-53373119 TTTTTTTAAAGCAGTCTGGAAGG - Intergenic
1117990961 14:61433029-61433051 TTTTTTTTGAAGAGGTTGGGGGG - Intronic
1118019961 14:61701463-61701485 TTTTTTCCAAGTAGTTTGGGAGG + Intronic
1118583397 14:67327439-67327461 TTTTTTTTCCGGGGTGTGGGGGG + Intronic
1119244481 14:73092191-73092213 TTTTTTTTAAGGGTGGTGGGGGG + Intronic
1119304140 14:73593492-73593514 TTTTTTTTAATTAGTCAGTGTGG - Intronic
1120517133 14:85484205-85484227 TTTTATTTAAGTAGTTTTGGGGG + Intergenic
1120950493 14:90036802-90036824 TTTTTTTTAAGGGGCGGGGGAGG - Intronic
1121206126 14:92169312-92169334 TCTTTTTTAGGGGGTGTGGGGGG - Exonic
1121307092 14:92913334-92913356 TTTATTTTAAAGAGCTTGGGAGG + Intergenic
1121737835 14:96230960-96230982 TTTTTTTTAAGGGGAATGAGTGG + Intronic
1121842773 14:97148385-97148407 TTTTTTTTTAAGAGACAGGGGGG - Intergenic
1121871639 14:97413620-97413642 TTTTTTTGGAGGGGTCTGTGGGG - Intergenic
1122494462 14:102142604-102142626 TTTTTTTTAATTAGCCAGGGTGG - Intronic
1123484329 15:20673766-20673788 TTTTTTTTAAGTAATGTGGAAGG - Intergenic
1123537056 15:21242734-21242756 TTTTTTTTAAGTAATGTGGAAGG - Intergenic
1124794724 15:32766544-32766566 TTTATTTTAAGAAGATTGGGCGG - Exonic
1124986540 15:34622092-34622114 TTTTTTTTAAAGTGTCTTAGAGG + Intergenic
1126527380 15:49671557-49671579 TTTTTTTTTAGAATTTTGGGAGG - Intergenic
1126586522 15:50293869-50293891 TTGTTCTTAAGGCTTCTGGGGGG - Intronic
1126611407 15:50533147-50533169 TTTTTTTTTAGGAGGCATGGTGG - Intronic
1129066074 15:72905015-72905037 TTTTTTGTAAGGAATCTGTCTGG - Intergenic
1130310825 15:82752565-82752587 TTTTTTTTAATTAGCCAGGGTGG - Intergenic
1131016329 15:89060385-89060407 TTTTTTTTAAAAAGGCTGGCCGG - Intergenic
1131161609 15:90108739-90108761 TTTTATTGGAGGGGTCTGGGGGG - Intergenic
1131890941 15:96970751-96970773 CTATTTTTAAGGGGGCTGGGTGG - Intergenic
1134194391 16:12147885-12147907 TTTTTATTTTGGAGCCTGGGAGG + Intronic
1134256154 16:12613298-12613320 TTTTTTTTAAGCAGCGGGGGTGG - Intergenic
1135408131 16:22212968-22212990 TTCTTTTTTAAGAGACTGGGTGG - Intronic
1135514607 16:23120143-23120165 CTTTTTTTAAGGAGGAAGGGGGG + Intronic
1135988851 16:27204675-27204697 TATTCTTTAAGGTGGCTGGGTGG - Intronic
1136688849 16:32013421-32013443 TTTTTTTGAAAGAGTTTGTGAGG - Intergenic
1136789444 16:32956932-32956954 TTTTTTTGAAAGAGTTTGTGAGG - Intergenic
1136880368 16:33896998-33897020 TTTTTTTGAAAGAGTTTGTGAGG + Intergenic
1137839862 16:51630371-51630393 TCTTGTTTAAGGGCTCTGGGAGG + Intergenic
1138332599 16:56227045-56227067 TGTTTTTTAAGGGGTGTGGCGGG + Intronic
1139451939 16:67035016-67035038 TTTTTTTTAACTAGTGTTGGGGG + Intronic
1139838608 16:69860195-69860217 ATTCTTTAAAGGAGTCGGGGAGG + Intronic
1139934568 16:70559905-70559927 TTTTTTTTGAGGGGTGCGGGGGG + Intronic
1140492158 16:75346868-75346890 TTTTTTTTCAGGAGTGGGGTGGG - Intronic
1140505879 16:75472289-75472311 TTTTTTTTAAGAAGCCTGAGGGG + Exonic
1203091644 16_KI270728v1_random:1218406-1218428 TTTTTTTGAAAGAGTTTGTGAGG - Intergenic
1142564237 17:829147-829169 TTTTTTTTAGGGGGGCGGGGTGG + Intronic
1142651368 17:1355102-1355124 TTTTTTTTAAAAAATCTTGGGGG - Intronic
1143939289 17:10522887-10522909 ATTTTTTTCAGGATTCTTGGTGG + Intronic
1144392881 17:14812514-14812536 TTTTTTTTAAGTATTCAGGTGGG - Intergenic
1144398385 17:14869001-14869023 TTTTTTTTTTGGCGTTTGGGTGG - Intergenic
1144959418 17:19036542-19036564 ATTTTTTTAAGGAATGGGGGTGG - Intronic
1144975741 17:19137982-19138004 ATTTTTTTAAGGAATGGGGGTGG + Intronic
1146067368 17:29646972-29646994 TTTTTTTTAAAGAGTCGGCCAGG + Intronic
1146651415 17:34609148-34609170 TTTTGAGTATGGAGTCTGGGGGG + Intronic
1147151701 17:38519582-38519604 TTTTTTTGAAAGAGTTTGTGAGG - Intergenic
1148357423 17:46984858-46984880 TGTTTCTGAAGGTGTCTGGGTGG - Intronic
1148555284 17:48575377-48575399 TTTTTTTCAAAGAGTCTGATGGG - Intronic
1149327500 17:55547046-55547068 TTTTTTTTTTGGAGACAGGGTGG - Intergenic
1149806651 17:59624156-59624178 TTTTTAGAAAGGTGTCTGGGGGG - Intronic
1151172823 17:72262004-72262026 TTTTTCTTAAGCAGTATTGGAGG + Intergenic
1152896004 17:82911747-82911769 TTCCTTTTCAGGGGTCTGGGAGG + Exonic
1153176491 18:2379545-2379567 TTTTTTTTAATGAGTTTTGAGGG - Intergenic
1155424366 18:25690896-25690918 TTTTTTTTTAGCAGTGTGGTAGG + Intergenic
1155552401 18:26979029-26979051 TTTTTTTTAAAGATTGTGGCAGG + Intronic
1156707392 18:39899759-39899781 TTTTTTTTTTGGAGTGGGGGTGG - Intergenic
1157001651 18:43533853-43533875 TTTTGTTTAAATAGTCTTGGGGG - Intergenic
1157330442 18:46700290-46700312 TTTTGTTTGAGGAGACAGGGAGG - Intronic
1157776803 18:50402339-50402361 TTTCTTTTAAGGATTTTAGGAGG - Intergenic
1157876215 18:51276126-51276148 TTTCTCTTATTGAGTCTGGGTGG + Intergenic
1159338181 18:67098765-67098787 TTTTTTTTAAATACTCAGGGAGG + Intergenic
1159518830 18:69493274-69493296 TTTTTTCTAAGAAGTAAGGGAGG + Intronic
1161225485 19:3143010-3143032 ATGTTTTTACAGAGTCTGGGAGG - Intronic
1161622836 19:5308372-5308394 TTGCCCTTAAGGAGTCTGGGGGG - Intronic
1163541637 19:17914768-17914790 TTTTTTTAAAGAAGTGGGGGTGG + Intergenic
1163739252 19:19000563-19000585 TATTTTTTAAGGAGACCAGGAGG + Intronic
1164063682 19:21696040-21696062 TTTCTTTTAAGGATTTTAGGAGG + Intergenic
1164486431 19:28659900-28659922 TTTTTTTTAAGGAGGCTAAAAGG - Intergenic
1164510857 19:28896008-28896030 GCTTTTTTAAGGAGTTTGGTGGG + Intergenic
1164954686 19:32371948-32371970 TTATTCTTAAGGAGTCTTGCGGG + Intronic
1165177170 19:33938965-33938987 TTTATTCTCAGGAGTCGGGGTGG - Intergenic
1166346168 19:42167451-42167473 TTTTTTTTTTGGAGTTTGGGGGG - Intronic
1167160220 19:47762626-47762648 TGTTTTTTAAAGAGACAGGGTGG - Intergenic
925067525 2:940026-940048 TTTTTTTCCAGAATTCTGGGTGG + Intergenic
925894936 2:8463792-8463814 TTTTTTTTTTGGAGTCTCTGTGG - Intergenic
927387564 2:22553020-22553042 TTTTTTTTAAAGAGTAAAGGCGG + Intergenic
927573167 2:24177543-24177565 TTTTTTTTAAATAGTCTGGGTGG + Intronic
927604492 2:24474255-24474277 TTTATTTTAACCAGTCTGGTAGG - Intergenic
928401030 2:30978960-30978982 TTGTGTTTTGGGAGTCTGGGTGG - Intronic
929232167 2:39571035-39571057 GTTTTTATAAGGAGTCAGAGAGG - Intergenic
929987410 2:46748496-46748518 TTTTTCTTATGGTGTCAGGGAGG + Intronic
931096273 2:58944140-58944162 TTTTTTTTAACTTTTCTGGGTGG + Intergenic
931341529 2:61406665-61406687 TTTTTTTACAGGAGCTTGGGGGG - Intronic
931394808 2:61877511-61877533 TTTTTTTTAATAATTCTAGGTGG - Exonic
931892881 2:66694522-66694544 TTATTTTTAAGGTGCCTGGGAGG - Intergenic
932190695 2:69739581-69739603 TTTTTTTTAAAGAGACACGGTGG + Intronic
932252075 2:70253235-70253257 TTTTTTTTTTGGAGGTTGGGGGG + Intergenic
932617495 2:73243196-73243218 TTTCTTTTCAGGAGTGTGGAGGG + Intronic
932631817 2:73351274-73351296 TATTTTTTAAAAAATCTGGGTGG - Intergenic
932632617 2:73358727-73358749 TTTTTTTTTGGGAGTCGGGGGGG + Intergenic
932879922 2:75491774-75491796 TTTGTTGTAAGGACTCTTGGAGG - Intronic
933628150 2:84626098-84626120 TTTTTTTTAGGGGATCTGTGAGG - Intronic
933751972 2:85608687-85608709 TTTTTTTTGAGGATTTTGTGTGG - Exonic
934297414 2:91753782-91753804 TTTTTTTTAAGCATCCTGGAAGG + Intergenic
935336518 2:102021879-102021901 TTGTTTTCAGGAAGTCTGGGAGG + Intronic
936719067 2:115227929-115227951 TTTTTTTTTTGGAGACAGGGTGG + Intronic
936879722 2:117234936-117234958 TTTTTTATAAGGTGTCAGGAAGG - Intergenic
938057587 2:128228300-128228322 TTTTTTTTTAGGAGTTTGGGAGG + Intergenic
938265027 2:129922585-129922607 TTTGGATTAAGGAGTCCGGGTGG + Intergenic
939193777 2:138947451-138947473 TATTTTTTAAGGAGCATGTGAGG + Intergenic
939664652 2:144936159-144936181 TATTTTCTCAGGAGTCTGAGAGG + Intergenic
939786581 2:146520985-146521007 TTCTTTTTAAGAAGGTTGGGAGG - Intergenic
941029062 2:160492318-160492340 TTTTTTTAAATGAGTTCGGGAGG + Intronic
941744479 2:169071878-169071900 TTTTTTTTCAGATTTCTGGGTGG + Intronic
941764157 2:169278100-169278122 TTTTTTTTAAAGAGACTGTGGGG + Intronic
942565085 2:177258007-177258029 TATTTTTTAAAGATTCTGAGGGG - Intronic
943685576 2:190814242-190814264 ATTTTTTTGAGGAGTGGGGGAGG - Intergenic
944569928 2:201034080-201034102 ATTTTTTTAAGTGGTATGGGTGG - Intronic
945014975 2:205505867-205505889 TTTTTTTTAAAAAGGTTGGGCGG - Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945224645 2:207521125-207521147 TTTTTTTTACCAAGTCTGGATGG + Intergenic
945649059 2:212537756-212537778 TTTTTTTTAAGAGGTCAGGCAGG + Intronic
945960291 2:216126953-216126975 TTTTTATTAAACAGTCTGGCTGG + Intronic
945966321 2:216191280-216191302 GTATTTTTAAGGACACTGGGTGG - Intronic
946281470 2:218668792-218668814 TTGTTTTTAAGGAGTTTAGCAGG - Intronic
946510264 2:220348472-220348494 TTTTTTTTAATGAATCTAAGAGG - Intergenic
947222353 2:227805565-227805587 TTTGTTTTAAGGAGTCACTGTGG + Intergenic
947922501 2:233889987-233890009 TTTTTTTTCAGGAGTAAGGTGGG + Intergenic
948341902 2:237260082-237260104 TTTTTTTTAATGATTCTTGCAGG + Intergenic
1170900621 20:20459432-20459454 TTTTTTTTTAGGTCTTTGGGTGG + Intronic
1172096398 20:32462592-32462614 TTTTTTTTAAGGGTTGTGGGAGG - Intronic
1172470689 20:35192410-35192432 GTGTTTTTAAGGATTCAGGGTGG + Intergenic
1173894907 20:46543346-46543368 TTTTTTTTTTGGAGTCTTGCTGG + Intronic
1174715476 20:52753266-52753288 TTTTTTTTAAGAACTGAGGGTGG - Intergenic
1175446309 20:59022613-59022635 TTTTATTTAAGGAGTTCAGGTGG + Intronic
1175666993 20:60869464-60869486 TTTTTTTTAAGGAATCAGATAGG + Intergenic
1175727225 20:61327176-61327198 TTTCTTTTATGGCTTCTGGGTGG - Intronic
1176358288 21:5970921-5970943 TTTTTTTTGAGAAGTTTGGCTGG + Intergenic
1176950069 21:15034000-15034022 TTTTATTTAAAGAGTCTAGTGGG - Intronic
1177281806 21:18990427-18990449 ATTTTTTTAAGCAGACAGGGAGG - Intergenic
1177414530 21:20776885-20776907 TTTTTTCAAAGGAGTCTCAGGGG + Intergenic
1178051114 21:28748539-28748561 TACTTTTGAAGGAGTCTGTGAGG + Intergenic
1178325761 21:31644289-31644311 TTTTAATTAAGGACTCAGGGAGG - Intergenic
1178503434 21:33144485-33144507 TTTTTTTTAAGCATTCCGGCTGG + Intergenic
1178867270 21:36339487-36339509 TTTTTTTTGAGAAGACGGGGTGG - Intronic
1179592037 21:42415281-42415303 TTTGTTTTTAGCAGTCGGGGAGG - Intronic
1179765230 21:43567629-43567651 TTTTTTTTGAGAAGTTTGGCTGG - Intronic
1181505334 22:23352348-23352370 TTTTTTTTAAGGATAATTGGCGG + Intergenic
1181819452 22:25464235-25464257 TTTTTTTTTAAGAGACGGGGCGG + Intergenic
1182363590 22:29763030-29763052 TTTTTTTAAATTAGGCTGGGTGG + Intronic
1182661692 22:31929594-31929616 TTATTTTTTATGAGTCTGGCTGG + Intergenic
1183404248 22:37622668-37622690 TTTTTTTTCAGCACTTTGGGAGG - Intronic
1183804128 22:40193846-40193868 TTTTTTTTTTGGAGGGTGGGTGG - Intronic
1184185165 22:42859762-42859784 TTTCTTTTGAGGAGTCTCGCCGG + Intronic
1184283261 22:43451034-43451056 TTTTTTTGATGGAGTCTTGCTGG + Intronic
1185308828 22:50141339-50141361 TTTTTTTTTATGAGTTTGGGGGG + Intronic
950344844 3:12284267-12284289 TTTTTTTTAAGGAGACTTATGGG - Intergenic
950430093 3:12945518-12945540 TTTTTTTTTTGGAGTGTGGAAGG - Intronic
950730637 3:14953579-14953601 TTCTTTTTAAGGAACATGGGTGG - Intronic
950942020 3:16902256-16902278 TTTTTTTTAAGGAGTTGGCAAGG + Intronic
951001342 3:17563676-17563698 TTTTTAAAAAGGAGTCTGGAAGG + Intronic
952034982 3:29189426-29189448 TTTTTGTAAAGGAGTGTGGTAGG - Intergenic
954199243 3:49014388-49014410 TTCTTTTGCAGGATTCTGGGCGG + Exonic
954454882 3:50592440-50592462 TTTTATTCAAGGAATCAGGGAGG - Intergenic
954618712 3:51983702-51983724 TTTTTTTTTAGGAGGGCGGGGGG + Intronic
954823236 3:53349162-53349184 TGCTTTTTAAGAAGTCTGGCGGG - Intergenic
956371218 3:68564115-68564137 TAATTTTTAAGGAGTCTTGAGGG + Intergenic
956757220 3:72400784-72400806 TATTTTTTTAGGAGTATGGTTGG - Intronic
956812223 3:72874682-72874704 TTTTTTTTAACCATTCTGGTGGG - Intergenic
956829066 3:73027952-73027974 TTTTTTTTTAAGAGACGGGGTGG + Intronic
956878258 3:73484884-73484906 TTCTTTTTGAGCAGACTGGGAGG + Intronic
957269093 3:78005627-78005649 TATTTGCTAAGAAGTCTGGGGGG + Intergenic
957980876 3:87509314-87509336 TTGTTTTTAAGGATTTAGGGTGG + Intergenic
958875864 3:99616381-99616403 TTTATTTTAAAGAGTGTTGGTGG - Intergenic
958972247 3:100624706-100624728 TTTTGTATAAGGAGTCAGGAAGG + Intronic
959216120 3:103452137-103452159 TTTTTTTGATGGAGTCTCGCTGG - Intergenic
959426682 3:106198512-106198534 TTTATTTTAAGAAATCTGGCCGG + Intergenic
959493383 3:107019775-107019797 TTTTTTTTAAGTAGTATGGATGG + Intergenic
960246870 3:115409318-115409340 TTTTTTTTATGGCATCTGGATGG - Intergenic
960351763 3:116602511-116602533 ATTTTTTTAAGAAGGGTGGGCGG - Intronic
962473722 3:135737542-135737564 TCTTTTCCAAGGAGTCCGGGAGG - Intergenic
962632089 3:137288365-137288387 TTTTTTTTAATGAATCTGAAGGG - Intergenic
962731393 3:138286687-138286709 TTTTTTTTAAGATCACTGGGTGG + Intronic
963075798 3:141345274-141345296 TTTTTTTTAATGGCTTTGGGAGG + Intronic
963440241 3:145332184-145332206 TTTTTCTTAAGGAGTGTGCATGG - Intergenic
963705846 3:148687431-148687453 TTTTTTTTAATGAGTTGAGGTGG + Intergenic
963806090 3:149724485-149724507 TTTTTTTTAAGGAGTCTGGGGGG - Intronic
963905831 3:150773051-150773073 TTTTTTTTAAAGAGTCGGAATGG - Intergenic
964227011 3:154415924-154415946 TTTTTGTTAAGATGACTGGGTGG + Intronic
965520504 3:169664735-169664757 TTTCTTTTATGGTGTCTGGCAGG - Intergenic
966443693 3:179976436-179976458 TTTTTTTGGAGGGGTGTGGGGGG + Intronic
966777277 3:183553963-183553985 TTTTTTTTGAGGTGCTTGGGGGG - Intronic
967286374 3:187874621-187874643 TTTTTTTTTGGTAGTCTAGGTGG - Intergenic
967871696 3:194235054-194235076 TTTTTTTTCAGGAATGCGGGTGG + Intergenic
968742123 4:2336563-2336585 TCTTTTTTAGGGAGTGGGGGGGG - Intronic
969666774 4:8562189-8562211 TTTTTTTTAATGGGGGTGGGAGG - Intronic
970122097 4:12766645-12766667 TTTTTTTCAACGATTCTGTGAGG + Intergenic
970345622 4:15149847-15149869 TTTTTTTTAATGGGTATGGTGGG - Intergenic
970512150 4:16791735-16791757 ATTTTGTAAAGGAGGCTGGGAGG + Intronic
970725486 4:19039349-19039371 TTTTTTTTAATGAGCCTTAGAGG - Intergenic
971142596 4:23940858-23940880 TTTTTTTTGTAGAGTCTGGAAGG - Intergenic
971641796 4:29143529-29143551 TTTTTGTTAAGTAGTCTGGAAGG + Intergenic
971913632 4:32829360-32829382 TTTTTTTTAAGGAAGCTCAGTGG - Intergenic
972271480 4:37514599-37514621 TTTTGTTTCAGGAGTCTGTGGGG - Intronic
974372563 4:61036938-61036960 TATTGTTTTAGTAGTCTGGGGGG + Intergenic
974524051 4:63025410-63025432 TTCTTTTTAAGGGGTCTGATGGG + Intergenic
975165247 4:71171169-71171191 TTTTTTTTAAGAATGGTGGGAGG + Intergenic
976535767 4:86214497-86214519 TTTTTTTTAAGGAATCTTAAGGG - Intronic
977537249 4:98268558-98268580 TTTTTTTCAAGGAGTCTTTAAGG - Intronic
977828647 4:101563923-101563945 ATTTTTTTCAGCAATCTGGGGGG - Intronic
978364163 4:107963117-107963139 TATTTTTTAAGGAGTTTAAGAGG - Intergenic
978508833 4:109493148-109493170 ATCCTTTTAAGAAGTCTGGGAGG + Intronic
978593386 4:110350996-110351018 CTTTATTTAAGCAGTTTGGGAGG + Intergenic
979694709 4:123599918-123599940 TTTTTTTTTGGGAATCAGGGTGG + Intergenic
981982786 4:150815264-150815286 TTTTTTTAAAGGACTTTGGATGG + Intronic
982269897 4:153575735-153575757 ATTTGTTAAAGGAGTATGGGAGG + Intronic
982724076 4:158887013-158887035 TTTTCCTTAAGGTGTATGGGAGG + Intronic
983343186 4:166492667-166492689 TGCTTTTAAAGGAGTTTGGGAGG + Intergenic
983918696 4:173320788-173320810 TTTTTTTTAAGTATACTGAGGGG + Intronic
984353416 4:178624537-178624559 TTTTTTTCAAGGAGTTTTGTAGG + Intergenic
985935725 5:3096446-3096468 TTTTATTTCAGGAGTTTTGGGGG - Intergenic
987009775 5:13750362-13750384 TTTTCTTTAGGGAGTATGTGAGG - Intronic
987852007 5:23367380-23367402 GTTTTTTTAAGAAGACAGGGTGG + Intergenic
989446309 5:41533856-41533878 TTTTTTTTATGGAGTCCAGGTGG + Intergenic
989455982 5:41645039-41645061 TTCTTTTTTAGGAGTTTAGGAGG - Intergenic
989648151 5:43658961-43658983 TTTTTTTTTAGGGGGGTGGGTGG + Intronic
989857054 5:46310190-46310212 TTCTTTTTATGGAATCTGGAAGG - Intergenic
990711096 5:58581864-58581886 TTTTTTTGAACTAATCTGGGAGG + Intergenic
992315682 5:75551397-75551419 TTTTTTTTTAAGAGGTTGGGGGG - Intronic
992813240 5:80410109-80410131 TTCTTTTTGAGGGGGCTGGGGGG + Intronic
992975656 5:82116547-82116569 TTTTATTTCAGGAGTGAGGGAGG + Intronic
993760847 5:91795272-91795294 TTTCTTTTAAGCACTCTGAGAGG + Intergenic
994151956 5:96457704-96457726 ATTTTTTGAAGGAGTCTGGATGG + Intergenic
994349766 5:98731102-98731124 TTATTTTTAAGGATTTTGGCTGG - Intergenic
995252290 5:110007233-110007255 TTTTTTTTAAAGAAGGTGGGAGG + Intergenic
996724106 5:126658845-126658867 TTTTTTGGGAGGAGTTTGGGGGG - Intergenic
997538027 5:134637774-134637796 TTTTTTTTTAAGAGACAGGGAGG - Intronic
999370902 5:151054676-151054698 TTTTTTTTAAGGGGTGTTGGGGG - Intronic
1000199318 5:158992191-158992213 ATTTATTTAAGGATTCTGGAAGG - Intronic
1001192809 5:169646367-169646389 TTTTTCTTAGGGTGTCTGTGAGG - Intronic
1001772813 5:174308719-174308741 TTCTTTTCAAGGAGGCTGTGTGG - Intergenic
1002760196 6:195908-195930 TTTGTTTTCAGGATTCTGTGAGG - Intergenic
1003282260 6:4704306-4704328 TTATTTTTAAGAAGTCTGGCTGG - Intergenic
1003798760 6:9637198-9637220 TTTTTTTTAAAGAGTCAAGCAGG + Intronic
1003870681 6:10400200-10400222 TTTTTTTTAATGAGTGTGTATGG - Intronic
1003896542 6:10613477-10613499 TTCTTTGTCAGGACTCTGGGAGG - Intronic
1004181300 6:13382645-13382667 TTTTTTTTTAAAAGTCTGTGGGG - Intronic
1004368241 6:15030069-15030091 TCTTTTTTAAGGAATTCGGGAGG - Intergenic
1004418724 6:15448651-15448673 TTGTTTTAAAACAGTCTGGGAGG + Intronic
1005217398 6:23547189-23547211 TTTTTTTTAAGAAGAATTGGTGG + Intergenic
1005326442 6:24706248-24706270 TTTGTTTTTTGGAGTCTGGAAGG + Exonic
1005615352 6:27567265-27567287 TTTTTTTTAAAGAGACGGAGTGG - Intergenic
1006268044 6:32941685-32941707 TATTTTTCAAGGAGTCTGAGAGG - Intronic
1006409889 6:33866952-33866974 TTATTTTCAAGGAGTCTTGATGG + Intergenic
1006859441 6:37160341-37160363 TTTTTTTTAAAGAGACGGGTTGG - Intergenic
1007009968 6:38407031-38407053 TCTTTTGTAAGGAGAATGGGAGG + Intronic
1007481607 6:42153951-42153973 TAATTTCTAAGGAGGCTGGGAGG - Intergenic
1007569377 6:42878492-42878514 TTTTTATTCAGGAGGCCGGGTGG - Intergenic
1007663499 6:43500892-43500914 GTTGTTTTAGGGACTCTGGGAGG + Intronic
1008107541 6:47455628-47455650 TTTTTTTTAATGATCCTGGAGGG - Intergenic
1008395388 6:51000501-51000523 TTTTATTTTAGGAGGCTGAGTGG - Intergenic
1008441357 6:51535317-51535339 CTTTTTTTAAGGGGGATGGGAGG + Intergenic
1008683207 6:53896327-53896349 TTGTTTTTAATGGGTGTGGGGGG + Intronic
1008775754 6:55035675-55035697 TTATTTTAAATGAGTCGGGGAGG - Intergenic
1009647594 6:66426447-66426469 TTTTTTATAAGGTGTCAGGAAGG - Intergenic
1010788968 6:80042165-80042187 TTTTTTTTCAAAAGTCTTGGAGG - Exonic
1012111470 6:95240907-95240929 TTTTATTTAATGACTCGGGGTGG - Intergenic
1013034628 6:106368851-106368873 TTTTTTTTAAGTAGTAGGTGAGG - Intergenic
1013728424 6:113130789-113130811 TTTATTTTAAGTAATCTGTGTGG - Intergenic
1014271990 6:119346902-119346924 ATATTATTAAGGAGTCTGGGAGG + Intronic
1014376322 6:120679518-120679540 TTTTTATGAAGTAGTTTGGGTGG + Intergenic
1015578327 6:134696904-134696926 TTTTTTTTAATGTGTCTGTCTGG + Intergenic
1015679502 6:135789467-135789489 TCTTTCTTAAGGAGCTTGGGTGG + Intergenic
1016319791 6:142830409-142830431 TTTTATTTTAAGAGGCTGGGAGG + Intronic
1016793265 6:148089440-148089462 TTTTTTTTCAGTATTCTGGGTGG - Intergenic
1018857119 6:167682635-167682657 TTTTTTTTTTTGAGTCGGGGGGG + Intergenic
1021547868 7:21835854-21835876 TTTTTTTTGAGGAGTCTTTGGGG - Intronic
1021610890 7:22456979-22457001 TTTTTTTTAAGTATCCTGGGTGG + Intronic
1021778996 7:24083348-24083370 AGTTTTTTAAGGAATCTGGTGGG - Intergenic
1022383562 7:29882833-29882855 CTTTTTATAAGAATTCTGGGGGG - Intronic
1022845710 7:34207590-34207612 TTTTTTTTCAGGGGCTTGGGAGG + Intergenic
1022983074 7:35623022-35623044 ATATTTTTGAGGAGTATGGGTGG - Intergenic
1024796264 7:53025177-53025199 TTTATTTTAAGGGGTCTGGGAGG - Intergenic
1024973481 7:55092008-55092030 TTTTTTTTAAGGAGATAGAGTGG - Intronic
1026209875 7:68294693-68294715 TCTTTTTTGAGGGGTCTGGAGGG - Intergenic
1026571258 7:71533230-71533252 TTTGTTTTATGGATTCTGGCAGG - Intronic
1026627293 7:72006853-72006875 AGTTATTTTAGGAGTCTGGGAGG - Intronic
1028130235 7:87162821-87162843 TTTTTTTTAAGGTCTTTGGTTGG + Intronic
1028625460 7:92872112-92872134 TTTTTTCTGTAGAGTCTGGGGGG + Intergenic
1028986794 7:97015768-97015790 TTTTTTTTAAGAAGTGGGTGAGG - Intergenic
1029552006 7:101241656-101241678 TTTTTTTTAAAGAGACAGGGTGG + Intronic
1029691219 7:102183330-102183352 TTTTTTTTAATGAGCCAGAGTGG + Intronic
1030292146 7:107883479-107883501 TTTTCTTAAAGGAGTGAGGGCGG + Intergenic
1030913246 7:115279172-115279194 GTATATTTAAGGAGTGTGGGAGG + Intergenic
1031263556 7:119553835-119553857 TTTCTTCAAAGGAGTCTGTGAGG - Intergenic
1032160511 7:129505950-129505972 TTTTCCTTAAGGAGTTTGGAGGG + Intronic
1032544891 7:132733764-132733786 TTTTTTTTTAAGAGACAGGGAGG - Intergenic
1033601739 7:142893604-142893626 TTTTTTTTAAGGAGGTGGTGGGG - Intergenic
1034506759 7:151498443-151498465 TTTTTTTTATAGAGACTGGGGGG - Intronic
1036579121 8:10056186-10056208 TTTTTTTTTTGGTGTATGGGAGG - Intronic
1038306621 8:26409088-26409110 TTTTTTTTAATGAAACTGGTAGG + Intronic
1038840004 8:31175992-31176014 TTTTTTTTTAAGAGTATGGAAGG + Intergenic
1038991491 8:32873079-32873101 TTTTTTTTAAGGGGACTGAAGGG + Intergenic
1040689076 8:49911985-49912007 TTTTTCTATAGGGGTCTGGGAGG + Exonic
1040919556 8:52600719-52600741 TTTTTTTTAAGGAGCCCCAGGGG - Intergenic
1043222123 8:77679768-77679790 TTTTTTTGGAGGAGTTTGGCAGG + Intergenic
1043493002 8:80768266-80768288 TATTTTTTAAGGAGTCTGAAAGG - Intronic
1044254515 8:90045021-90045043 TTTTTTTTCAGGAGTGTGTTTGG + Intronic
1044414805 8:91925674-91925696 TTTTATTTAAGGGGCCTGGTAGG - Intergenic
1044706151 8:95010715-95010737 TTTTTTTTAAAGAGTCTGAAAGG - Intronic
1045081308 8:98628807-98628829 TTTTTTTTTTGGAGTGTGGAGGG - Intronic
1046068455 8:109222903-109222925 TTTTTTTAAAGGAGTCCAAGGGG - Intergenic
1046120572 8:109841255-109841277 TTTTTTTTTTTGAGACTGGGAGG + Intergenic
1046809830 8:118520870-118520892 TTTTTTATATGTATTCTGGGTGG + Intronic
1047833393 8:128660711-128660733 TTTATTTTAAGCATTTTGGGTGG - Intergenic
1048333288 8:133485657-133485679 TTTTTTCTAAGGAGTCAAGCGGG - Intronic
1048453255 8:134553177-134553199 TGTTTATTAAGAACTCTGGGTGG + Intronic
1049370535 8:142262216-142262238 TGTTTTTCAAGGAGTTTGGCAGG - Intronic
1050338852 9:4615830-4615852 CTGCTTTTAAGGAGTTTGGGAGG + Intronic
1050546528 9:6714359-6714381 TTTTTTTTAAATAGGCGGGGTGG - Intergenic
1050674118 9:8032420-8032442 TGGTTTTTAAGGACTCTAGGTGG - Intergenic
1050929731 9:11308136-11308158 TTTTTTCAAAGGAGTCTGAGGGG - Intergenic
1051168722 9:14295613-14295635 TTTTTGAGAAGGAGTCTGGCTGG - Intronic
1051554771 9:18370443-18370465 TTTTTATTATGGATTCGGGGGGG - Intergenic
1052381525 9:27776047-27776069 TTTCTTGACAGGAGTCTGGGAGG - Intergenic
1052552119 9:29965487-29965509 TTTTATTTAGGCAGTCTGTGTGG + Intergenic
1052727687 9:32249453-32249475 TTTTTTTGAAGGATGATGGGTGG - Intergenic
1052958116 9:34270612-34270634 TTTTTTTTTAAGAGACGGGGTGG + Intronic
1052958155 9:34270921-34270943 TTTTTTTTTAAGAGACAGGGTGG - Intronic
1053595565 9:39557543-39557565 GTTGTTTAAAGGAGTCTAGGCGG + Intergenic
1054883187 9:70166870-70166892 TTTATTTTATGGGGTGTGGGGGG - Intronic
1056423149 9:86449346-86449368 TTTTTTTTAACGACTTTGGGTGG - Intergenic
1057398897 9:94704872-94704894 TTTTTTTTAAGTCCCCTGGGTGG - Intergenic
1057691157 9:97287649-97287671 TCATATTTCAGGAGTCTGGGTGG + Intergenic
1058632809 9:107007229-107007251 TTTTTTATAAGGAGTCATAGGGG - Intronic
1058963611 9:110015943-110015965 TTTTCTTTCAGGAGTCGGGTGGG + Exonic
1059151946 9:111956791-111956813 TTTTTCTTCAGGACCCTGGGAGG + Intergenic
1059642782 9:116234042-116234064 TTTTTTTTAAGGTGTCTAGTTGG + Intronic
1059917746 9:119122669-119122691 TTTTTTTTAAGAATCCTGGCCGG + Intergenic
1060795902 9:126513215-126513237 TTTTTTTTAAAGGGTTTGGGAGG - Intergenic
1061358382 9:130123663-130123685 TTTTTTTTTAAGAGACAGGGAGG + Intronic
1061471285 9:130827950-130827972 TTTTTTTTAAGCAGTATTTGTGG - Intronic
1062570328 9:137182009-137182031 TTGTTTTTAAGGAGTCTGACGGG - Intronic
1186684153 X:11907261-11907283 TTTTTTTAATGGACTCTGAGTGG - Intergenic
1187000802 X:15175354-15175376 TTTTTTTTTAGGATGCTGTGGGG + Intergenic
1187037949 X:15562095-15562117 TCTGTGTTAAGGAGGCTGGGAGG + Intronic
1187934495 X:24322438-24322460 TTTTTTTTAATGAGTGGGTGGGG + Intergenic
1188052401 X:25503780-25503802 TTTTTTTTCATGTGTCTGTGAGG + Intergenic
1188189177 X:27153280-27153302 TTTTTTTTCAGGAATCTGATGGG + Intergenic
1188407576 X:29830751-29830773 TCTTTTTTAAAGAGTCTGAGAGG - Intronic
1188464539 X:30464864-30464886 TTTTTTTGAAGGAGGTAGGGAGG - Intergenic
1188505772 X:30883139-30883161 TATTTTTTAAGGGGTTTAGGGGG - Intronic
1189171289 X:38912251-38912273 TATTTTGTATGGAGTCTGAGAGG + Intergenic
1189751075 X:44223479-44223501 TTTATTAAAAGGAGCCTGGGTGG - Intronic
1190385018 X:49877215-49877237 TTTTTTTTAAGTAGTCCTCGTGG - Intergenic
1192487800 X:71545285-71545307 TTTTTTTTAAGGGGTTGGGGTGG - Intronic
1193595655 X:83441883-83441905 TTTTGTTTAAGGTGTAAGGGAGG - Intergenic
1193699837 X:84747275-84747297 TTTTTTCAAAGGAGTCTCAGGGG - Intergenic
1194740806 X:97572090-97572112 TTTTTTTTAAGGAATCAGATTGG + Intronic
1195629989 X:107045121-107045143 GTTTTTTAAAGCAGTCTGAGTGG + Intergenic
1195861468 X:109388012-109388034 TTTTTTTAAAGAAGTTTGGTAGG + Intronic
1196994807 X:121371271-121371293 TTTTTTTAACGGAGTCAGGCTGG + Intergenic
1197063754 X:122214364-122214386 TTTTTTGTAAGTAGTGTGAGGGG - Intergenic
1197622785 X:128769761-128769783 TTTTTCTTCAGTAGTCAGGGTGG - Intergenic
1197752997 X:129978602-129978624 TATTTTTTAAGGGGTGTGTGTGG + Intergenic
1198082242 X:133251056-133251078 TTTTTTTTAAGGTGGCTGCTTGG + Intergenic
1198461484 X:136866892-136866914 TTTTTTTTAAAGAGACGGCGGGG - Intronic
1198975826 X:142334079-142334101 TTTTTTTTAATCAGGCTGTGTGG - Intergenic
1199512456 X:148637896-148637918 TTTTTTCTTAGAAGGCTGGGAGG + Intronic
1200024868 X:153249392-153249414 TTTTTCTGAACGAGTATGGGAGG + Intergenic