ID: 963819267

View in Genome Browser
Species Human (GRCh38)
Location 3:149869996-149870018
Sequence ATTCAGTAGCACCATACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963819267_963819272 22 Left 963819267 3:149869996-149870018 CCTACTGTATGGTGCTACTGAAT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 963819272 3:149870041-149870063 CTTTGGTAGAATTACAAAGGAGG 0: 1
1: 0
2: 1
3: 16
4: 233
963819267_963819273 23 Left 963819267 3:149869996-149870018 CCTACTGTATGGTGCTACTGAAT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 963819273 3:149870042-149870064 TTTGGTAGAATTACAAAGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 280
963819267_963819269 5 Left 963819267 3:149869996-149870018 CCTACTGTATGGTGCTACTGAAT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 963819269 3:149870024-149870046 CTGTGATTTGGCATCTCCTTTGG 0: 4
1: 29
2: 44
3: 72
4: 240
963819267_963819268 -7 Left 963819267 3:149869996-149870018 CCTACTGTATGGTGCTACTGAAT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 963819268 3:149870012-149870034 ACTGAATAGCTACTGTGATTTGG 0: 1
1: 0
2: 2
3: 31
4: 216
963819267_963819270 19 Left 963819267 3:149869996-149870018 CCTACTGTATGGTGCTACTGAAT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 963819270 3:149870038-149870060 CTCCTTTGGTAGAATTACAAAGG 0: 1
1: 0
2: 1
3: 20
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963819267 Original CRISPR ATTCAGTAGCACCATACAGT AGG (reversed) Intronic