ID: 963819267

View in Genome Browser
Species Human (GRCh38)
Location 3:149869996-149870018
Sequence ATTCAGTAGCACCATACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963819267_963819270 19 Left 963819267 3:149869996-149870018 CCTACTGTATGGTGCTACTGAAT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 963819270 3:149870038-149870060 CTCCTTTGGTAGAATTACAAAGG 0: 1
1: 0
2: 1
3: 20
4: 158
963819267_963819272 22 Left 963819267 3:149869996-149870018 CCTACTGTATGGTGCTACTGAAT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 963819272 3:149870041-149870063 CTTTGGTAGAATTACAAAGGAGG 0: 1
1: 0
2: 1
3: 16
4: 233
963819267_963819268 -7 Left 963819267 3:149869996-149870018 CCTACTGTATGGTGCTACTGAAT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 963819268 3:149870012-149870034 ACTGAATAGCTACTGTGATTTGG 0: 1
1: 0
2: 2
3: 31
4: 216
963819267_963819269 5 Left 963819267 3:149869996-149870018 CCTACTGTATGGTGCTACTGAAT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 963819269 3:149870024-149870046 CTGTGATTTGGCATCTCCTTTGG 0: 4
1: 29
2: 44
3: 72
4: 240
963819267_963819273 23 Left 963819267 3:149869996-149870018 CCTACTGTATGGTGCTACTGAAT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 963819273 3:149870042-149870064 TTTGGTAGAATTACAAAGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963819267 Original CRISPR ATTCAGTAGCACCATACAGT AGG (reversed) Intronic
900810063 1:4795085-4795107 CTTCTGTGGCCCCATACAGTTGG - Intergenic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
905303443 1:37001363-37001385 ATTCAATAACTCCATACATTAGG + Intronic
907119674 1:51997407-51997429 ATTCAGGAGCTGCATTCAGTTGG + Intergenic
907744862 1:57203092-57203114 ATTGAGTAACAGCAAACAGTGGG + Intronic
908174043 1:61536654-61536676 ATTCAGAATAACCAAACAGTGGG - Intergenic
910973396 1:92880070-92880092 TTTCAGTAGCAGCCTCCAGTTGG - Intronic
911598227 1:99820904-99820926 ATTCACTAGTATGATACAGTTGG - Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916246287 1:162691409-162691431 CTTCAGTACAACCAGACAGTAGG - Intronic
916728105 1:167541815-167541837 ATTCAGAAGCACCATAATGGGGG + Exonic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1063380385 10:5581698-5581720 ATATAGTAGCACCAAACATTTGG - Intergenic
1066392398 10:34988192-34988214 AATCAGTATCAGCAGACAGTAGG - Intergenic
1068574941 10:58674739-58674761 ATTCAGCAGCAGGAGACAGTGGG + Intronic
1068585111 10:58789396-58789418 TGACAGTAGCACCATACATTCGG - Exonic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072054886 10:91745224-91745246 ATTCAACAGCACCATGCCGTAGG + Intergenic
1072759416 10:98043606-98043628 ATTAAGTAGGGACATACAGTGGG - Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082963966 11:58947080-58947102 ATTCAGTAGGATCATTCTGTGGG - Intronic
1084290497 11:68162588-68162610 ATTCAGAATCACCATAAAATGGG - Intronic
1085431720 11:76456853-76456875 ATTCAACAGCACTATCCAGTTGG + Intronic
1092704234 12:11267104-11267126 ATTCATTGGCACAATAAAGTTGG + Intronic
1092708234 12:11308150-11308172 ATTCATTGGCACAATAAAGTTGG + Intronic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1093166088 12:15805508-15805530 AATCAGCAGCACCATGCAGCAGG + Intronic
1093552140 12:20426340-20426362 AAGCAGTTGCAACATACAGTTGG - Intronic
1094340484 12:29405927-29405949 ACTCAGTTGTACAATACAGTAGG + Intergenic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1096311301 12:50523454-50523476 ATTCAGGAACACAGTACAGTTGG - Intronic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1106854525 13:33835065-33835087 ATAAAGTAAAACCATACAGTGGG + Intronic
1109817942 13:67611894-67611916 ATTCAGAAGCATCACACAGATGG - Intergenic
1111323861 13:86665389-86665411 ATTTAGTAACATCAAACAGTAGG - Intergenic
1111737781 13:92164318-92164340 AATCAAAAGCAACATACAGTGGG + Intronic
1115178730 14:30596923-30596945 ATACAGAAGCACCAGACAGAGGG - Intronic
1117182167 14:53201983-53202005 ATACAGTAGGGCTATACAGTAGG + Intergenic
1118022160 14:61728613-61728635 ATTCATTGGCTACATACAGTTGG + Intronic
1120817350 14:88876147-88876169 AAGCAGTAGCACAGTACAGTGGG - Intronic
1123913252 15:24991994-24992016 ATTCAGTAACACAATCCTGTCGG - Intergenic
1128300958 15:66566011-66566033 TTTCAATAGCTCCATTCAGTGGG + Intergenic
1138133771 16:54503903-54503925 ATTCACTAGCGCCATGCATTGGG + Intergenic
1141708066 16:85680307-85680329 ATTCAGCAGCGCCATTCAGTGGG + Intronic
1144539793 17:16129810-16129832 ATTCAGTATCCCCTTAGAGTTGG + Intronic
1148865905 17:50628453-50628475 CTGCAGTAGCACCAGACAGGTGG - Intergenic
1149256810 17:54836546-54836568 TTTCAGTCCCACCATTCAGTGGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1154346544 18:13547914-13547936 TTTCAGTCCCACCATTCAGTAGG + Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1163273389 19:16267577-16267599 ATTCAGTGACACCATTCAGGAGG + Intergenic
926701814 2:15809119-15809141 AATCAGTAGCACCTTAGAGGAGG - Intergenic
927874534 2:26646532-26646554 ATGCAGTATATCCATACAGTAGG + Intergenic
929153264 2:38767566-38767588 GTTCAGTACCTGCATACAGTGGG - Intronic
929262577 2:39882532-39882554 ATGCAGTATCAACATACACTGGG - Intergenic
930508925 2:52319836-52319858 ATGCAGTATAACCATAAAGTAGG - Intergenic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
935528865 2:104207487-104207509 ATTCTGCAGCAAGATACAGTAGG - Intergenic
936500578 2:113062871-113062893 CAGCAGTAGCACCATCCAGTGGG - Exonic
936851567 2:116905229-116905251 ATTAAGCAGCACCATCCTGTAGG - Intergenic
937940359 2:127280480-127280502 ATTCTGCAGCTCCATCCAGTTGG + Exonic
938577579 2:132619010-132619032 ACCCAGTAGCACCAGGCAGTGGG + Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
941018282 2:160381649-160381671 ATTCAGTTTCACCATACTGGGGG + Intronic
943602563 2:189939210-189939232 TTTCAGTGGCACCATGCTGTAGG + Intronic
946942524 2:224784658-224784680 GTTCAGTAAAACCATACAGAGGG + Intronic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1170427716 20:16251861-16251883 ATTCAATAGCATCATAAACTAGG + Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171179087 20:23078621-23078643 ATTCATTAACAACATACACTTGG - Intergenic
1173955710 20:47031056-47031078 ATTCAGTTGCAACACGCAGTGGG + Intronic
1176664922 21:9677543-9677565 ATTCCTCAGCACCATGCAGTTGG - Intergenic
1183387367 22:37522618-37522640 ATTCAGGAGCACCCTCCAGCAGG + Intergenic
953482754 3:43265470-43265492 ATTCATGTGCACCCTACAGTGGG + Intergenic
954112886 3:48445421-48445443 AGCCAGTAGCACCCTTCAGTAGG + Intergenic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957777482 3:84772546-84772568 GTTTAGTAGAACCATACTGTTGG + Intergenic
959897159 3:111617752-111617774 TTTCAGTCCCACCATTCAGTAGG - Intronic
962107196 3:132403215-132403237 ATTCAGTAGCAGTTTAGAGTGGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963025245 3:140912867-140912889 ATTCAGAAGCACTAGCCAGTAGG - Intergenic
963235976 3:142956503-142956525 ATTTAGAAGCACAATACATTGGG + Intronic
963819267 3:149869996-149870018 ATTCAGTAGCACCATACAGTAGG - Intronic
964203782 3:154148015-154148037 ATTAAGTAGCACCTTATAGCAGG - Intronic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
966107813 3:176358880-176358902 ATTTAAAAGGACCATACAGTGGG + Intergenic
966226115 3:177599791-177599813 CTTCAGAAACACCATACATTTGG + Intergenic
968838272 4:2981285-2981307 TTTCAGTCCCACCATTCAGTGGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
969510261 4:7613687-7613709 ATTCAGTAGCAGCTTACACTAGG - Intronic
970617867 4:17784480-17784502 ATTCACTAGCTGTATACAGTTGG - Intergenic
971144184 4:23959188-23959210 ATTGAGGAGCACCATATGGTGGG - Intergenic
971276134 4:25198850-25198872 ATATAGTAGCACCATTAAGTAGG + Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
973020772 4:45203583-45203605 ATTCAGTAAGAACATACACTGGG - Intergenic
973538916 4:51914882-51914904 ATTCAATAGCACCAGATAGTTGG - Exonic
978347591 4:107788212-107788234 ATTCAGTCCCACCATTCAGCTGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981067639 4:140501977-140501999 ATTCACTAGCAACATAGTGTTGG + Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
983306023 4:165988288-165988310 ATTAAGTAGCATAATACACTAGG + Intronic
983447062 4:167865674-167865696 ATTAATTAGCACTTTACAGTGGG - Intergenic
986412754 5:7497845-7497867 TTTCAGTAGCACCAGACTGAAGG + Intronic
986518107 5:8584194-8584216 ATCCAGAAGCAGCAGACAGTGGG - Intergenic
990785573 5:59414996-59415018 ACTCAGTAGCAGCATCCAGAGGG + Intronic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993631960 5:90297264-90297286 ATACAGTGGCACCATGCAGAGGG - Intergenic
994518026 5:100794627-100794649 TTTCAGTCCCACCATTCAGTGGG - Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
996400087 5:123052915-123052937 CTTAAGTAGCTCCATGCAGTTGG - Intergenic
997164583 5:131646191-131646213 ATTCTGTAGTACCACACTGTTGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999780413 5:154845140-154845162 ATTCAGCAGAACAATACAATTGG - Intronic
1000769689 5:165337171-165337193 ATTCAGTAGCACGAAACTGACGG - Intergenic
1001018403 5:168162427-168162449 ATGCAGTAGCAAGACACAGTGGG - Intronic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1007967871 6:46019296-46019318 ATTCTGTAACAGCATATAGTTGG - Intronic
1009988363 6:70809885-70809907 ATTCAGTATCACTATATATTAGG + Intronic
1011897885 6:92254539-92254561 ATTCAGTAACATCATACTGGTGG - Intergenic
1012568412 6:100690372-100690394 GTTCAGTAGTACATTACAGTTGG - Intronic
1012895966 6:104949473-104949495 ATTCAGTAGAACCCTGCACTTGG + Intergenic
1012914133 6:105150226-105150248 ATTCAGTAGCACAATAAATAGGG - Intergenic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1014611596 6:123554255-123554277 ATTGAGTACTACCATACAGAAGG - Intronic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1016651129 6:146462228-146462250 ATTCAGTAGCACTGCACTGTTGG - Intergenic
1017076152 6:150620729-150620751 AATCAGTTGCACCATGCATTTGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023088307 7:36594358-36594380 ATCCTGTAGCACCAGAGAGTTGG + Exonic
1024788879 7:52939826-52939848 ATTCTGTAGCCCCATCCACTAGG + Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1028054482 7:86225624-86225646 TTTCAGTTCCACCATTCAGTGGG + Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1037382350 8:18299964-18299986 ATTCAGTAGGACAACAAAGTCGG + Intergenic
1041288977 8:56290423-56290445 ATTCAGTGGCTCCACTCAGTGGG + Intergenic
1042002341 8:64138699-64138721 ATTCAGCAGCACTGTACTGTAGG + Intergenic
1044581661 8:93831795-93831817 ATTCAGCAGAACCATTCAGAGGG - Intergenic
1044852364 8:96441616-96441638 ACTCAGTAGCTGCATACAGGTGG + Intergenic
1046994851 8:120507034-120507056 ATTCAATACCACAAAACAGTAGG - Intronic
1047596074 8:126379041-126379063 ATTCTGTAGCACCATGGAGATGG - Intergenic
1048254336 8:132894279-132894301 ATTCAGGAACACCACACAGCAGG + Intronic
1052434322 9:28406867-28406889 TATCAGTAGCACAATGCAGTTGG - Intronic
1203661179 Un_KI270753v1:44206-44228 ATTCCTCAGCACCATGCAGTTGG + Intergenic
1188382018 X:29506675-29506697 ATTCAGCAGTACTATACTGTAGG - Intronic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1189096866 X:38149846-38149868 ATCCACTAGCACCATACTGAAGG + Exonic
1190031728 X:46979795-46979817 ATTCAGTATCACCAGCCATTAGG - Intronic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1197551103 X:127893815-127893837 ATTTAGCAACACCACACAGTAGG - Intergenic
1198372018 X:135998931-135998953 ATACAATGGCACCAAACAGTAGG - Exonic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1200178099 X:154132366-154132388 ATTCGTGTGCACCATACAGTGGG - Intergenic