ID: 963822079

View in Genome Browser
Species Human (GRCh38)
Location 3:149908662-149908684
Sequence CCTGTATTCAGCCCAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963822079_963822085 25 Left 963822079 3:149908662-149908684 CCAGCAGTTGGGCTGAATACAGG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 963822085 3:149908710-149908732 GGACAGAAGGCTCTGCTGTGTGG 0: 1
1: 0
2: 1
3: 35
4: 299
963822079_963822084 12 Left 963822079 3:149908662-149908684 CCAGCAGTTGGGCTGAATACAGG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 128
963822079_963822082 4 Left 963822079 3:149908662-149908684 CCAGCAGTTGGGCTGAATACAGG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 963822082 3:149908689-149908711 TGCCTGGAAAGCTGATCTATAGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963822079 Original CRISPR CCTGTATTCAGCCCAACTGC TGG (reversed) Intronic
900873848 1:5327093-5327115 CCTGGAGTTAGCCAAACTGCAGG + Intergenic
902952105 1:19893171-19893193 CCTGGAGTTAGCCAAACTGCAGG + Intronic
905212901 1:36386353-36386375 CTTTTATTGAGCCTAACTGCAGG - Intergenic
908035254 1:60044615-60044637 CCTGGGTTCAGGCCAGCTGCAGG + Intronic
909761213 1:79289647-79289669 CCTGTGTTCAGGCCTAGTGCAGG + Intergenic
912777837 1:112517173-112517195 CCTGTACTCTGCGCACCTGCTGG + Exonic
913177534 1:116288582-116288604 CAGGTATTCAACCCAACTGGTGG + Intergenic
915491120 1:156250549-156250571 TCTGGAGTCAGCCCCACTGCAGG + Exonic
916168584 1:161984276-161984298 CCTGTTTTCTCCCCACCTGCAGG - Exonic
923139834 1:231151782-231151804 CCTGCATTCTGTGCAACTGCAGG + Intergenic
1062934397 10:1375132-1375154 CCTCTTTTCAGCACAACTCCAGG + Intronic
1065676534 10:28180949-28180971 CCTGTAAACAGCACTACTGCAGG + Intronic
1067134155 10:43593558-43593580 ATTGTCTTCAGCCCAACTCCAGG + Intergenic
1070643229 10:78183890-78183912 CCTTTATTCAGCCCCACTGTGGG + Intergenic
1076068387 10:127466835-127466857 GCTGTATTCAGCCCTCCTGGAGG + Intergenic
1077503667 11:2920439-2920461 GCTGTGTCCAGCCCAGCTGCAGG - Intronic
1085448697 11:76617728-76617750 TCTTAATTCAGCCCAAATGCTGG - Intergenic
1088499350 11:110467644-110467666 CCTGTATTCAGCTCATTTGAAGG - Intergenic
1090912625 11:131134780-131134802 CCTGTACCCCACCCAACTGCTGG + Intergenic
1092927744 12:13287478-13287500 CCTGCAGTTAGCCAAACTGCAGG - Intergenic
1097907845 12:64938655-64938677 GATGTATTCAGCACATCTGCTGG - Intergenic
1098741572 12:74179238-74179260 CCTGTCTTCTGCCCACCTGCAGG + Intergenic
1100471796 12:94900473-94900495 CCTGTCTTCAGCCCAAATAGTGG - Intronic
1102929330 12:116850458-116850480 CCTGTGCCCAGCCCACCTGCTGG + Exonic
1104849125 12:131862893-131862915 CCTCTATTCATCCCACCCGCTGG + Intergenic
1108910216 13:55540552-55540574 CCAGAATTCAGCCCCACTTCTGG - Intergenic
1113032559 13:106010402-106010424 CCTTTATTCAGCACATCTGCGGG - Intergenic
1113853871 13:113433442-113433464 CCTGTTTTCAGCCCAAAAGCAGG - Intronic
1119962263 14:78873048-78873070 TCTGTTTTCAGCCCCACTGCTGG + Intronic
1121440014 14:93942620-93942642 CCTGAATCTAGCCCAACAGCAGG + Intronic
1121505231 14:94472147-94472169 CCTCTCTTCGGCCCCACTGCTGG + Intronic
1123099688 14:105788300-105788322 CTTGTATTCTGCCCACCTGTGGG - Intergenic
1125721195 15:41845956-41845978 CCTGTATGCAGCCAACCTCCAGG + Exonic
1128532938 15:68467191-68467213 CCATTCTTAAGCCCAACTGCTGG + Intergenic
1129785062 15:78304401-78304423 CCTGGGCTCAGCCAAACTGCAGG + Intergenic
1129878561 15:78992770-78992792 CCTGCAAGCAGCCCATCTGCCGG + Intronic
1132411470 15:101581339-101581361 CCTGCATCCAGCCCTACTGTTGG + Intergenic
1133202724 16:4214173-4214195 CCTGTTTTCAGCCCACCTCTGGG + Intronic
1136277080 16:29185180-29185202 CCTGGATGAAGCCCATCTGCTGG - Intergenic
1138709108 16:58949327-58949349 CTTCTATTCAGCCTTACTGCCGG - Intergenic
1140061929 16:71578074-71578096 ACTGTATTCAACCCCACTGGAGG - Intergenic
1142903585 17:3027923-3027945 CCCCTATTCTGACCAACTGCAGG - Intronic
1146767624 17:35537653-35537675 ACTGTCCTCAGCCAAACTGCAGG - Intronic
1147205617 17:38835375-38835397 CCTGCATTCAGCCCACCTCTTGG + Intronic
1148775177 17:50091198-50091220 CCTGAATTCAGCCCGACTAAGGG - Intergenic
1149456762 17:56794515-56794537 TCTGTTTTCAGCCCACCAGCAGG - Intronic
1149597630 17:57873590-57873612 CCTGTATGCTGTCCAGCTGCTGG + Exonic
1149624186 17:58067944-58067966 CCTGTCTTCAGCCCCTCTCCAGG - Intergenic
1150143209 17:62747210-62747232 GATGCATTCAGCCCAACTACAGG + Intronic
1151468878 17:74305394-74305416 GCTGTCTTCAGACCAAATGCGGG - Exonic
1153410419 18:4786551-4786573 CCGTTATTCAGCCCTACAGCAGG - Intergenic
1153926988 18:9843053-9843075 CCTCTAATCAGTCCAACTGCAGG - Intronic
1156367051 18:36438952-36438974 CCTGTGTTCAGCACAACTTTGGG - Intronic
1160844099 19:1159119-1159141 CCTGTCTTGAGCCCATCTGGAGG - Intronic
1160874560 19:1291085-1291107 CCTGGACTCTGCCCAACTTCCGG - Intronic
1163379727 19:16957244-16957266 CCAGCAGTCAGCCCACCTGCTGG + Intronic
924969111 2:108348-108370 CCAGTCTTCAGCCCCAGTGCTGG + Intergenic
928101437 2:28439817-28439839 CTTGGAGTCAGCCCACCTGCCGG + Intergenic
928266384 2:29815551-29815573 CCTTTCTACAGCCCAACAGCAGG - Intronic
931208249 2:60168373-60168395 CCTGGAATCAGCACCACTGCGGG + Intergenic
933639890 2:84747839-84747861 CTTGCATTCTGCCCAACTGCAGG + Intronic
936529415 2:113265422-113265444 TCAGGGTTCAGCCCAACTGCAGG - Intronic
937487991 2:122335699-122335721 CCTGTATCCAGCCCAGGCGCAGG - Intergenic
939059339 2:137400891-137400913 CCTGTATTCAGGCCCACTAGTGG + Intronic
940057187 2:149525661-149525683 CCGGTATTCAGCCCCATTCCTGG + Intergenic
943646565 2:190412775-190412797 CCAGTACTTAGCCCCACTGCTGG + Intronic
1170087830 20:12555151-12555173 CCTGCATACAGCCAAACTGATGG + Intergenic
1173656369 20:44702950-44702972 CCTGAGGTCAGCCCAGCTGCTGG - Intergenic
1174138075 20:48394126-48394148 CCTTTATTCAGCCTAACTCACGG + Intergenic
1181142065 22:20813055-20813077 ACTGGATGCAGCCCAGCTGCTGG + Intronic
1183270341 22:36858392-36858414 CCTGTATTCAGCAGAACCACGGG + Intergenic
949375018 3:3379689-3379711 CCTGTGTTCAGCTGAACTTCTGG + Intergenic
953257366 3:41304881-41304903 CCTGCATTTGGCCCAGCTGCAGG + Intronic
954396565 3:50296414-50296436 CCTTTATTCAGCCACACTGACGG + Exonic
955581234 3:60425189-60425211 CCTGTATTCACTTCCACTGCAGG - Intronic
960932435 3:122867231-122867253 TCTGTATTCAGCACAAAAGCTGG - Intronic
961244620 3:125440617-125440639 CCTGCATCCTGCCCACCTGCAGG - Intergenic
963822079 3:149908662-149908684 CCTGTATTCAGCCCAACTGCTGG - Intronic
964183289 3:153913343-153913365 CCTGGATTCAGCCCCTTTGCTGG - Intergenic
965869498 3:173249318-173249340 CCTGTCTGTAGCCCCACTGCAGG - Intergenic
966729108 3:183135777-183135799 CCAGTTGTCAGCCCACCTGCAGG - Exonic
967903108 3:194477335-194477357 CCTTTATTCAGCTGCACTGCTGG - Intronic
973080375 4:45984090-45984112 CCTGAAGGCAGCCCAACTTCTGG - Intergenic
975197506 4:71542729-71542751 CCTGAATTCACCCCTACTGTAGG + Intronic
980305931 4:131061477-131061499 CCTGAACTCAGCCCATCAGCAGG - Intergenic
993681332 5:90881934-90881956 CCTGGATTCAAGCAAACTGCCGG + Intronic
996916648 5:128720284-128720306 TCTGTATGCACACCAACTGCAGG - Intronic
997575389 5:134971752-134971774 CCAGTATTTATCCCAACTGTGGG - Intronic
1000116954 5:158162378-158162400 CCTGTTTTCAGAGCACCTGCAGG - Intergenic
1006581269 6:35079108-35079130 ACTGCATTCAGCACAAGTGCAGG - Intronic
1007121022 6:39381537-39381559 CTAGCCTTCAGCCCAACTGCTGG + Intronic
1020079797 7:5281378-5281400 CCTGTATCCATCCCACCTGGTGG + Intronic
1023203126 7:37720164-37720186 CCTGCCTTCTGCCCAACTCCTGG - Intronic
1023640741 7:42254310-42254332 CCTGCATTCCGCCCACATGCTGG - Intergenic
1024293799 7:47827151-47827173 CCTGAATTCCTCCCATCTGCTGG + Intronic
1025199116 7:56950836-56950858 CCTGTATCCATCCCACCTGGTGG - Intergenic
1025672831 7:63626097-63626119 CCTGTATCCATCCCACCTGGTGG + Intergenic
1028666365 7:93348144-93348166 CCTGGATGCAGTGCAACTGCAGG + Intronic
1030754630 7:113272838-113272860 GCTGTATTCTGTCGAACTGCAGG - Intergenic
1032257050 7:130305843-130305865 CCTGCATTCAGCCAAACGGCCGG - Exonic
1034966041 7:155391624-155391646 CCCGTGTCCAGCCCACCTGCAGG + Intronic
1039470435 8:37810003-37810025 CCTAAATTCAGACCAGCTGCGGG - Intronic
1039811588 8:41053989-41054011 CCTGGACTCAGTCCTACTGCTGG - Intergenic
1044017168 8:87058568-87058590 CTTGTCTTCTGCACAACTGCAGG + Intronic
1049104382 8:140602642-140602664 GCTGTATTCATTCCAAGTGCGGG - Intronic
1049551714 8:143263070-143263092 CCTGTCTTCAGCCCTTCTCCAGG + Intronic
1052965200 9:34335291-34335313 CCAGTTTTCTTCCCAACTGCTGG + Intronic
1054344377 9:63899951-63899973 CCTGTAAACAGCCCCACAGCAGG - Intergenic
1059415076 9:114157176-114157198 CCACTTTTCTGCCCAACTGCTGG - Intronic
1186566963 X:10673238-10673260 CCTGTCTTCTGCTCACCTGCTGG + Intronic
1189369301 X:40415052-40415074 CCAGGATTCTGCCCAACTCCTGG + Intergenic
1198379920 X:136074369-136074391 CCTTTATTCAGCTACACTGCTGG - Intergenic
1199532579 X:148867207-148867229 CCAGTATCCAGCCAAACGGCTGG - Intronic