ID: 963822084

View in Genome Browser
Species Human (GRCh38)
Location 3:149908697-149908719
Sequence AAGCTGATCTATAGGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963822079_963822084 12 Left 963822079 3:149908662-149908684 CCAGCAGTTGGGCTGAATACAGG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963822084 Original CRISPR AAGCTGATCTATAGGACAGA AGG Intronic
901718916 1:11179516-11179538 AAGCTGGCCAAAAGGACAGAGGG - Intronic
902103134 1:14010562-14010584 AAGCTGAGCCATGGGGCAGATGG - Intergenic
909617545 1:77628650-77628672 AAGCTGAACACTAGGATAGAAGG + Intronic
912902329 1:113665271-113665293 AAGTTGATATATAGGAGAGATGG - Intronic
917926889 1:179796865-179796887 AAACTGTTCTCTAGGACAGCAGG + Intronic
920304512 1:205009978-205010000 AAGCCAATTTATAGAACAGATGG - Intronic
923016172 1:230128177-230128199 AGGCTATGCTATAGGACAGATGG - Intronic
924077560 1:240356633-240356655 AATCTGATCTTTAGAAGAGATGG - Intronic
1063403136 10:5767286-5767308 AAGATGATCTGTAGAACAAAGGG - Intronic
1071067210 10:81650077-81650099 AAGCTGAGCTATAGGTCTCAAGG + Intergenic
1075585261 10:123652637-123652659 AAGCTGATCAAGAGGGGAGAAGG + Intergenic
1075904086 10:126065564-126065586 AAGCTGAGCCATTGGTCAGATGG - Intronic
1077911618 11:6576965-6576987 AAGCTGTTCTGTAGCACGGATGG + Intronic
1080133210 11:28820627-28820649 GGGCTTCTCTATAGGACAGAGGG - Intergenic
1081311978 11:41585463-41585485 AATCTCATGTATAGGAAAGATGG + Intergenic
1083395643 11:62389882-62389904 AAGCTGCTCTTTAGGGCAGATGG - Intronic
1083822064 11:65178159-65178181 AAGCTGATTTAAAGGTCATATGG - Intronic
1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG + Intronic
1084279685 11:68079846-68079868 CACCTGATCTATAGGCCAAAGGG - Intronic
1086420574 11:86633676-86633698 ATGCTGTTCTATAGGCCAGAGGG + Intronic
1088927555 11:114317676-114317698 AAGCTGATCTATACATGAGAAGG - Intergenic
1090428742 11:126628733-126628755 AATCTGATGAATAGGAAAGATGG - Intronic
1093888429 12:24490164-24490186 AAGCTGAGTTATAGAACAAATGG - Intergenic
1106240707 13:27910638-27910660 CAGCTGCACTATAGGAAAGATGG + Intergenic
1109755757 13:66757191-66757213 AAGTTGCTCTAGAAGACAGAGGG - Intronic
1110097446 13:71546110-71546132 AAGCTGATCTGTTTGACATATGG - Intronic
1112599149 13:100838361-100838383 CAACCAATCTATAGGACAGAAGG - Intergenic
1115849806 14:37582469-37582491 ATGCTGCTCTATAAGACAAAGGG + Intergenic
1116766230 14:49073527-49073549 AATCTGCTCTATAGAACAAATGG + Intergenic
1117289398 14:54317911-54317933 AATGTGAACTATAGGAAAGAAGG - Intergenic
1117317273 14:54584042-54584064 AAGGTTATCTATGGGACAGCTGG - Intronic
1120330740 14:83090322-83090344 CAGCAGGTCTAAAGGACAGAGGG + Intergenic
1125242727 15:37594911-37594933 ATTCTTATCTATAGGACTGAGGG - Intergenic
1125342131 15:38685629-38685651 AAGCTGATTAATAGGAGACAAGG - Intergenic
1126745353 15:51820415-51820437 AATCTGCTCTATAGGCCAAATGG + Intergenic
1132474803 16:129247-129269 AAGCTGATCTGTGGCACAGGTGG + Intronic
1133075515 16:3277611-3277633 AAGCCGATTTCCAGGACAGATGG + Intronic
1134042117 16:11076729-11076751 GAGGTGATGTATAGGAGAGATGG - Intronic
1139954677 16:70687362-70687384 AACCCGATCTCCAGGACAGAGGG + Intergenic
1140708400 16:77653088-77653110 ATGCTGGTCTACAGGAGAGAAGG - Intergenic
1146987137 17:37230702-37230724 AAGCCTGTCTCTAGGACAGAGGG - Intronic
1153372809 18:4338658-4338680 AAGATGATAAATACGACAGACGG + Intronic
1155244983 18:23899296-23899318 AAGCAGATCTCTGGGACAGATGG + Exonic
1158886365 18:61830660-61830682 AGGCTGAACTAAAGGAAAGAGGG + Intronic
1159253971 18:65921548-65921570 AAGCTCAGCTATTGGGCAGATGG + Intergenic
1159973412 18:74680626-74680648 AAGCTGGTTTATAGGAATGAAGG + Intronic
1165787619 19:38471553-38471575 AACCAGATTTATAAGACAGAGGG + Intronic
1166407984 19:42536322-42536344 AATCTGAACTATAGAACAAATGG - Intronic
1168529313 19:57115014-57115036 AAGATGATCCAAAGGACAGCGGG + Intergenic
926983333 2:18594817-18594839 AAGCTGATCTAAGTGACAGGTGG - Intergenic
927004284 2:18831958-18831980 ATGCTGTGCTATAGCACAGAAGG - Intergenic
929307617 2:40381623-40381645 CATCTGTTCTATAGGACAGCTGG - Intronic
929830435 2:45342731-45342753 AAGCTGATCTGTGGGAGACAAGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933284148 2:80366504-80366526 AAGATGATCTGTAGGACACCAGG - Intronic
933731102 2:85456811-85456833 AAGCTGATCTATGTGACTGCTGG - Intergenic
934874290 2:97901177-97901199 ATGCTCATATATAGGACAGTGGG + Intronic
935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG + Intergenic
936530816 2:113276212-113276234 AAGCTGATCAGAAAGACAGACGG + Intronic
937502918 2:122502514-122502536 AAGTTGAATTATAGAACAGATGG - Intergenic
941567322 2:167125701-167125723 AAGCTGAACAATAGGAAATATGG + Intronic
943584777 2:189725535-189725557 AGGCATATCTATAGGACACAAGG + Intronic
946220206 2:218219119-218219141 AAGCTGATCTACAAGATAAATGG + Intronic
946867410 2:224054771-224054793 AAGAAGATCTATGGGACAGGAGG + Intergenic
947625474 2:231615601-231615623 AAGCTGATCAAGAGGACACCTGG - Intergenic
1170368255 20:15620090-15620112 AAGCAGTTCTCCAGGACAGAAGG + Intronic
1173182863 20:40817784-40817806 AAGCTCATCCATAGGCCAGTTGG + Intergenic
1173378646 20:42515057-42515079 AAGCTAATCTATAGATCCGATGG - Intronic
1180029719 21:45198269-45198291 AGGCTGATCAAGAAGACAGAAGG + Intronic
1180881664 22:19208475-19208497 AAGCAGATCCATAGCTCAGAAGG + Intronic
1183290618 22:36999681-36999703 AAGCTGACATAGAGGACACATGG + Intronic
949368519 3:3309158-3309180 AAGGTGAACTATAGGACACAAGG + Intergenic
952279383 3:31908509-31908531 CAGCTGATCTAGAGGCAAGATGG + Intronic
954556274 3:51519939-51519961 ATGCTGAGGTAAAGGACAGAAGG - Intergenic
956660097 3:71588894-71588916 AAGGTGATCTATAGTACATGTGG + Intergenic
958215913 3:90575442-90575464 AAACTGCTCTATAGAAAAGAAGG + Intergenic
959524678 3:107363425-107363447 AAGCACATCTATGGGTCAGAAGG - Intergenic
959537403 3:107501750-107501772 AAACTGGTTTACAGGACAGAAGG + Intergenic
962254322 3:133860075-133860097 AAGCTGAGGAATAGGCCAGAAGG + Intronic
963812392 3:149790835-149790857 GAGCTGCTCTAAAGGACAGTTGG - Exonic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
965706511 3:171513407-171513429 AAGTTGATCTATATGACAACTGG - Intergenic
965847170 3:172977085-172977107 AAACAAATGTATAGGACAGAAGG + Intronic
970111631 4:12644338-12644360 AAGGTGATTCAAAGGACAGATGG - Intergenic
973161784 4:47027868-47027890 AAACTGATCAATTGAACAGAAGG + Intronic
973875008 4:55208749-55208771 AAACAGATCAATAAGACAGAAGG + Intergenic
975822225 4:78283361-78283383 AAGGTGAGCTATTGAACAGATGG + Intronic
976463688 4:85343428-85343450 AAGCTGATTTTTAGGACAGGTGG - Intergenic
981826605 4:148949522-148949544 ATGCTGATCATTAGGACAAAGGG + Intergenic
987175080 5:15299662-15299684 AAGCCTAACTATAGGACAAATGG - Intergenic
988200790 5:28066330-28066352 AAGCTGATGTATAGCCCAGAGGG + Intergenic
988516412 5:31908452-31908474 AAGATGGTCTGTAGGAGAGAGGG + Intronic
989120869 5:38003252-38003274 ATACTGATCTCAAGGACAGATGG - Intergenic
989701448 5:44270086-44270108 AGGCTTATCTAGAGGACATACGG - Intergenic
989859873 5:46357481-46357503 AAGCTGATCTATCAAAAAGAAGG + Intergenic
991406526 5:66305712-66305734 AAGCTGAACTGAGGGACAGAGGG + Intergenic
992045692 5:72886724-72886746 CAGCTGATTTTTAGGAGAGACGG - Intronic
993738073 5:91501573-91501595 TATATGATATATAGGACAGAAGG + Intergenic
1000877376 5:166657602-166657624 AAGCTGATCGAAAGAACATAGGG + Intergenic
1002334441 5:178468298-178468320 AAGCTCATTAATAGGCCAGAGGG + Intronic
1003647746 6:7928264-7928286 AAACAGATCAATAAGACAGAAGG + Intronic
1003961459 6:11212983-11213005 AAGCTGATATATGAGAAAGATGG + Intronic
1003991094 6:11487305-11487327 AAGCTATTCTGTAGGGCAGAGGG + Intergenic
1004774612 6:18829623-18829645 AGGCTGATCAATAGCACTGAAGG + Intergenic
1008059693 6:46984426-46984448 AAGCTCATCTCTGGGAGAGATGG - Intergenic
1011388426 6:86822963-86822985 CTTCTTATCTATAGGACAGAAGG + Intergenic
1012864264 6:104598621-104598643 AAGCTTTTCTATAGGACCAATGG - Intergenic
1016407301 6:143744148-143744170 CAGATCATCCATAGGACAGAAGG + Intronic
1021329561 7:19318750-19318772 ATGTTGATCTATGGCACAGAAGG + Intergenic
1024107452 7:46107716-46107738 AAGCTGAGCTGCAGGACAAAGGG + Intergenic
1025026345 7:55519420-55519442 AAGCTGATCTATAAAACAATTGG + Intronic
1026517404 7:71084777-71084799 AATGTGTTCTATAAGACAGATGG - Intergenic
1027329681 7:77078538-77078560 TAGCTTGTCTAAAGGACAGAGGG - Intergenic
1029786081 7:102792800-102792822 TAGCTTGTCTAAAGGACAGAGGG + Intronic
1032938909 7:136766155-136766177 AAGCAAGTCTATAGGACTGAAGG + Intergenic
1033846831 7:145443927-145443949 AAGTTGATCTATAATACAGAGGG + Intergenic
1037250199 8:16884186-16884208 AAACGAATCTATATGACAGAAGG + Intergenic
1038765091 8:30420374-30420396 AAGCTAATCTATAAGTCAGCTGG + Intronic
1040861398 8:52002818-52002840 AAGCTGGTCTAGAGGAGACAGGG - Intergenic
1043192827 8:77248318-77248340 AGGCAGATTTATAGGAGAGAAGG + Intergenic
1044261864 8:90134443-90134465 CAGCTGATCTATCTGACAGGAGG + Intergenic
1044577684 8:93788797-93788819 AAACTTAACTACAGGACAGAAGG + Intronic
1047900549 8:129416994-129417016 GAGATGTTATATAGGACAGACGG - Intergenic
1048688162 8:136927735-136927757 AAGGAGAACTATAGGACAAAAGG - Intergenic
1051711604 9:19935916-19935938 AAGCTTCTCTAAAGGAAAGAAGG + Intergenic
1052980054 9:34441551-34441573 AAGCAGACCTAAAGGAGAGAGGG + Intronic
1058636673 9:107044695-107044717 AAGGTGAGCTCTAGGAGAGAAGG + Intergenic
1059032012 9:110708217-110708239 AATTTGATCTCTAGGAAAGAAGG - Intronic
1061453702 9:130682279-130682301 AAGCTGGCCTAAAGGAGAGAAGG - Exonic
1061622493 9:131820227-131820249 AAACTGACCGATAGAACAGAGGG - Intergenic
1193504536 X:82325946-82325968 AACCTGAACTATAGAACAAATGG - Intergenic
1195349183 X:103980742-103980764 AGGCAGATCCATAGGACATAAGG + Intergenic
1195356551 X:104044838-104044860 AGGCAGATCCATAGGACATAAGG + Intergenic
1195358260 X:104058097-104058119 AGGCAGATCCATAGGACATAAGG - Intergenic
1198069182 X:133131094-133131116 AAGCTGATCTAGAGATCAGCTGG + Intergenic
1199618641 X:149679546-149679568 AAGAGGATTAATAGGACAGATGG - Intergenic
1199624001 X:149723703-149723725 AAGAGGATTAATAGGACAGATGG + Intergenic
1200375889 X:155779829-155779851 ACAATGATCTATAGGACACAGGG - Exonic