ID: 963823563

View in Genome Browser
Species Human (GRCh38)
Location 3:149926503-149926525
Sequence CTAAAAACACAGAAGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1875
Summary {0: 1, 1: 0, 2: 12, 3: 153, 4: 1709}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963823563 Original CRISPR CTAAAAACACAGAAGAGGCT GGG (reversed) Intronic
900381533 1:2386588-2386610 CTAAAAATACAAAAATGGCTGGG - Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900666208 1:3817167-3817189 CTAAAAACACAAAATTAGCTGGG + Intronic
900744534 1:4352065-4352087 CTAAAAACACAAAATTAGCTGGG + Intergenic
901285648 1:8076582-8076604 CTAAAAATACAGAATTAGCTGGG + Intergenic
901387490 1:8920791-8920813 CAAAAAACAAAAAACAGGCTGGG + Intergenic
901406830 1:9054627-9054649 TTAAAAATATAGAAGAGGCTAGG + Intronic
901543096 1:9933929-9933951 CAAAAAACAAACAAAAGGCTAGG + Intronic
901555367 1:10027779-10027801 CTAAAAACACAAAATTAGCTGGG - Intergenic
901588718 1:10320860-10320882 CTAAAAACACAAAATTAGCTGGG - Intronic
902351018 1:15854643-15854665 CTAAAAACACAAAATTAGCTGGG - Intronic
902549861 1:17212791-17212813 CTAAAATGACAGAAGAGACCAGG - Intronic
902558769 1:17263073-17263095 CTAAAAATACAAAAGTAGCTGGG - Intronic
902762147 1:18588796-18588818 CTAAAAATACAAAAGTGGCTGGG - Intergenic
902972276 1:20062496-20062518 CTGAAAACTCAGAGCAGGCTGGG + Intronic
902979121 1:20110373-20110395 TTAAAAAGACAGAGGAGGCCGGG + Intergenic
903089482 1:20898889-20898911 CTAAAAATACAAAATAAGCTGGG - Intronic
903186343 1:21631388-21631410 TTAAAAATCCAGATGAGGCTGGG + Intronic
903201020 1:21738938-21738960 CTGAAAACACTGAAGATACTGGG + Intronic
903408318 1:23117794-23117816 TTAAAAACAAACAGGAGGCTGGG + Intronic
903489103 1:23714370-23714392 CTAAAAATACAAAATAAGCTGGG + Intergenic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
903914353 1:26752652-26752674 TGAAGAACACAGAAGAGACTGGG - Intronic
904080707 1:27871062-27871084 CTAAAAATACAAAAGTAGCTGGG - Intergenic
904104080 1:28062703-28062725 TTAAAAGCACAGAATAGGCTGGG + Intronic
904154334 1:28470392-28470414 CTAAAAAAAAAGAAAAGGCTAGG + Intronic
904159574 1:28513066-28513088 CTAAAAAAAAAAAAGAGGCTGGG - Intronic
904167776 1:28569394-28569416 CTTAAAAAACAAAATAGGCTGGG + Intronic
904215061 1:28912971-28912993 CTAAAAACAAAAACGAGGGTTGG - Intronic
904238530 1:29129232-29129254 CTAAAAATACAGAAATAGCTGGG - Intergenic
904245465 1:29184772-29184794 CTAAAAAAGTAGAATAGGCTGGG - Intergenic
904572708 1:31478863-31478885 ATAAAATCACAGAGGAGGCTGGG + Intergenic
904601641 1:31676027-31676049 CAAAGAACCCAGAGGAGGCTGGG + Intronic
904752769 1:32751222-32751244 CCAAGAACACAGGACAGGCTAGG - Intronic
905053405 1:35072784-35072806 CTAAAAATACAAAAAAGGCTGGG + Intronic
905094574 1:35458229-35458251 TTAAAAACAAAAAACAGGCTGGG - Intronic
905237436 1:36559890-36559912 CTCCCATCACAGAAGAGGCTGGG - Intergenic
905540399 1:38755947-38755969 CTCAAAAGAAAAAAGAGGCTGGG - Intergenic
905590123 1:39156168-39156190 CTAAAAATACAAAATAGGCCAGG - Intronic
905624851 1:39482632-39482654 CTAAAAATACAGAATTAGCTGGG + Intronic
905816064 1:40952032-40952054 CCAAAAAGACAGAACAGGCTGGG - Intergenic
905816316 1:40953683-40953705 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
905944836 1:41892822-41892844 CTCAAAAAACAGCAAAGGCTGGG + Intronic
906030137 1:42712849-42712871 CTAAAAATACAGAATTAGCTGGG - Intergenic
906031965 1:42728390-42728412 CTAAAAATACAAAATTGGCTGGG - Intergenic
906070066 1:43010007-43010029 CTAAAAACACAAAATTAGCTGGG - Intergenic
906123709 1:43413104-43413126 CTCAAAAAACAAAATAGGCTGGG + Intronic
906213861 1:44027812-44027834 CTAAAAACACAAAATTAGCTGGG + Intronic
906260642 1:44386062-44386084 TTAAAAATATAGAAGAGGCCGGG - Intergenic
906314458 1:44777230-44777252 CTAAAAATACAGAAGCAGCCGGG - Intronic
906340150 1:44972439-44972461 CTAAAAACACAAAATTAGCTGGG + Intronic
906449326 1:45931480-45931502 CAAAAACAACAAAAGAGGCTGGG - Intronic
906504290 1:46366548-46366570 CTAAAAAAAGAGAAGGGGGTTGG + Intergenic
906513046 1:46422496-46422518 GTAAAAGCACAGACGAGGCCAGG - Intergenic
906593231 1:47047890-47047912 ATAAAAGCACAGAACTGGCTGGG - Intronic
906738989 1:48162452-48162474 CAAAAAACATGGAAGAGGCCAGG - Intergenic
906985766 1:50681812-50681834 CAAAAAAAACAAAAGAGGCCGGG - Intronic
907121271 1:52010162-52010184 CAAAAAATAAAAAAGAGGCTGGG + Intergenic
907154340 1:52319461-52319483 CTAAAAACACAAAATTAGCTGGG + Intronic
907230246 1:52991122-52991144 CTAAAGAGAGTGAAGAGGCTAGG - Intronic
907434613 1:54436688-54436710 CTAAAAACACAAAATTAGCTGGG - Intergenic
907445343 1:54504159-54504181 TTAAAAAAAAAAAAGAGGCTGGG + Intergenic
907668674 1:56455136-56455158 CTAAAAACACAAAATAAGCTGGG + Intergenic
908073036 1:60484690-60484712 CAAAACACACTGAAGAGCCTTGG + Intergenic
908262259 1:62348283-62348305 CTAAAAATACAAAAGTAGCTGGG + Intergenic
908402117 1:63781084-63781106 CTAAAGACAAAGCAGAGGTTGGG + Intronic
908535388 1:65071990-65072012 CTTAAAACAAAGAGTAGGCTGGG + Intergenic
908640883 1:66222051-66222073 ACAAAAAGACAGAGGAGGCTGGG - Intronic
908856578 1:68436627-68436649 CTAAAAACACAAAATTAGCTGGG - Intronic
909025994 1:70482760-70482782 CTAAAAACACAAAATTAGCTGGG + Intergenic
909072491 1:71013539-71013561 CTAAAAATACAAAATTGGCTGGG + Intronic
909254431 1:73401462-73401484 CTAAAAACACAAAATTAGCTGGG - Intergenic
909635450 1:77812171-77812193 TTAAAAAAATAAAAGAGGCTGGG + Intronic
909771426 1:79427076-79427098 AAATAAACACAGAAGAGACTAGG + Intergenic
909869041 1:80715309-80715331 GTAAAAATACAAAAGAGGTTTGG - Intergenic
909946895 1:81673810-81673832 TTAAAAAACTAGAAGAGGCTGGG - Intronic
910007017 1:82410494-82410516 CTAAAAAGACAGAAGACACTGGG - Intergenic
910137237 1:83986678-83986700 CTAAAAACACAAAATTGGCCAGG + Intronic
910315484 1:85877656-85877678 TTAAAAACACACATGAAGCTGGG - Intronic
911075919 1:93874787-93874809 CTAAAAACACAAATCCGGCTGGG - Intronic
911422850 1:97666452-97666474 ATTAAAACACAGAAGGGGCCAGG - Intronic
911592571 1:99765304-99765326 TTAAAAATACAGAAGTGGCTGGG + Exonic
911603509 1:99873593-99873615 CTAAAAATACAGAATTAGCTGGG - Intronic
911703718 1:100986246-100986268 CTAAAAATACAAAATTGGCTGGG + Intergenic
912104654 1:106257224-106257246 CTAAAAATACAAAATTGGCTGGG - Intergenic
912775926 1:112506540-112506562 CTAAACACACAGGGGAGTCTGGG + Intronic
912949318 1:114109935-114109957 CTAAAGACACAGAAGGGGCAGGG + Intronic
913578826 1:120205721-120205743 CTAAAAATACAAAATTGGCTGGG - Intergenic
913629348 1:120692648-120692670 CTAAAAATACAAAATTGGCTGGG + Intergenic
913677120 1:121151234-121151256 CTAAAAACACAAAATTAGCTGGG + Intergenic
914028956 1:143938862-143938884 CTAAAAACACAAAATTAGCTGGG + Intergenic
914160495 1:145129086-145129108 CTAAAAACACAAAATTAGCTGGG - Intergenic
914223463 1:145700907-145700929 CTAAAAACTTAGCAGGGGCTGGG + Intronic
914243559 1:145869475-145869497 CTCCAAACACAAAACAGGCTGGG - Intronic
914560755 1:148817161-148817183 CTAAAAATACAAAATTGGCTGGG - Intronic
914612079 1:149313054-149313076 CTAAAAATACAAAATTGGCTGGG + Intergenic
914740047 1:150456926-150456948 AAAAAAAAAAAGAAGAGGCTGGG + Intronic
914842101 1:151256908-151256930 CTAAAAACACAAAATTAGCTGGG - Intronic
915171295 1:153979385-153979407 CTAAAAATACAGAATTAGCTGGG + Intergenic
915188348 1:154126271-154126293 CTAAGAACACTGAAGAGGCTTGG - Intronic
915241915 1:154529238-154529260 CTAAAAATACAAAAGTAGCTGGG - Intronic
915388712 1:155520699-155520721 CTAAAAACACAAAATTAGCTCGG + Intronic
915408480 1:155681189-155681211 CTAAAAACACAAAATTAGCTGGG - Intronic
915909339 1:159903095-159903117 CTAAAAACACAAAATTAGCTGGG - Intergenic
915978125 1:160403786-160403808 CTTAAGACACCTAAGAGGCTGGG - Intronic
916050848 1:161035904-161035926 CTAAAAACACAAAATTAGCTGGG + Intronic
916054050 1:161055492-161055514 CAAAAAACAAAAAACAGGCTGGG + Intronic
916086761 1:161275954-161275976 CTAAAAACACAAAATTAGCTGGG - Intronic
916176440 1:162043429-162043451 CTAAAAATACAAAAGTAGCTGGG + Intergenic
916296492 1:163226079-163226101 CTAAAAACACAAAATTAGCTGGG - Intronic
916347580 1:163811303-163811325 CTAAAAATACAAAATAAGCTGGG + Intergenic
916696786 1:167245572-167245594 CTAAAAACACAAAACTAGCTGGG - Intronic
916728547 1:167545529-167545551 TTAAAAGCACAGAAAAGGCCAGG + Intronic
916771881 1:167917302-167917324 CTAAAGTCACAGCATAGGCTGGG + Exonic
916772224 1:167921565-167921587 TTAAAAACACAGAAGAGAAATGG - Intronic
917110129 1:171539160-171539182 CTAAAAATACAGAATCAGCTGGG - Intronic
917257820 1:173134743-173134765 CCCAAAACACAGAAGAAGTTTGG - Intergenic
917443345 1:175085711-175085733 CTAAAAATACAAAATAAGCTGGG + Intronic
917832861 1:178912513-178912535 CTAACAAGCCAGAAGAGGCTGGG - Intronic
917878375 1:179307949-179307971 CTAAAAACACAAAATAAGCCAGG - Intronic
917921934 1:179757829-179757851 CGAAAAACAGTGAAGAGGATGGG + Intronic
918261961 1:182804421-182804443 CTTAAGAGAGAGAAGAGGCTGGG - Intronic
918619668 1:186588636-186588658 CAAAATTCACATAAGAGGCTGGG + Intergenic
919069139 1:192731909-192731931 CTAAAATCACAAAAAGGGCTGGG + Intergenic
919101072 1:193098377-193098399 CTAAAAACACAAAAGTTGCCAGG + Intronic
919634393 1:199989475-199989497 CTAAAAACACAAAATTAGCTGGG + Intergenic
919714278 1:200759437-200759459 CTAAAAACACAAAATTAGCTAGG - Intronic
919912376 1:202119401-202119423 CAAAAAAAACACAAAAGGCTGGG + Intergenic
919915650 1:202137464-202137486 CTAAAAATACAAAAGTGGCCAGG + Intronic
920324200 1:205149061-205149083 CTAAAAATACAAAATAGGCCGGG - Intronic
920372547 1:205488485-205488507 CTAAAAACTCACTGGAGGCTAGG + Intergenic
920410173 1:205753087-205753109 CTAAAAAAAAAAAAAAGGCTGGG - Intergenic
920464421 1:206169751-206169773 CTAAAAACACAAAATTAGCTGGG + Intergenic
921106384 1:211984144-211984166 TTAAAAACACTGAAGGGGCCAGG - Intronic
921190697 1:212705907-212705929 CTAAAAACACAAAATTAGCTGGG - Intergenic
921205908 1:212848597-212848619 CTCAAAAAACAAAAGAGGCCAGG - Intergenic
921252132 1:213308014-213308036 TTAAAGAGAAAGAAGAGGCTGGG + Intergenic
922418577 1:225443982-225444004 CTAAAAATACAGAATTAGCTTGG - Intergenic
922428952 1:225527869-225527891 CAAAAAACACAGAAAATCCTAGG + Intronic
922489577 1:226005152-226005174 CTAAAAACACAAAATTAGCTGGG + Intergenic
922699271 1:227749114-227749136 ATCCAAACACAGAAGATGCTCGG - Intronic
922770221 1:228177732-228177754 TTAAAGACACAGAAGAGGCTGGG - Exonic
922771524 1:228186538-228186560 GAAAAAACATAGAAGAGGCTGGG - Intergenic
923005199 1:230044115-230044137 TTAAAAACAGAGAAGAGGCTGGG + Intergenic
923152462 1:231245806-231245828 CTAAAAACACAAAATTAGCTGGG + Intronic
923451050 1:234117589-234117611 CTAAAAAAAAAAAACAGGCTGGG + Intronic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
923873751 1:238024355-238024377 CTAAAAACACAAAATTAGCTGGG + Intergenic
924147086 1:241087651-241087673 ATAAAACCATATAAGAGGCTGGG + Intronic
924228303 1:241941522-241941544 AAAAAAACACAGATGTGGCTGGG - Intergenic
924326955 1:242905043-242905065 GTTAAAAAACAGTAGAGGCTGGG + Intergenic
924353772 1:243147883-243147905 TTTAAAAAACAAAAGAGGCTGGG + Intronic
924555797 1:245117582-245117604 CTAAAAATACAGAATTAGCTGGG - Intronic
924556060 1:245119636-245119658 CTAAAAAAAAAAAGGAGGCTGGG + Intronic
924660952 1:246016285-246016307 CTAAAGAAACAGAACTGGCTGGG + Intronic
1062879418 10:966121-966143 CTAAAAAGACAGTAGAGGCAAGG + Intergenic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063318870 10:5033600-5033622 CAAAAAGTACAGAAGAGGCAGGG + Intronic
1063467278 10:6255283-6255305 CTAAAAACACAAAATTAGCTGGG - Intergenic
1063631869 10:7741471-7741493 GTAAAAACACAGAACAGGCCAGG - Intronic
1063650779 10:7934979-7935001 ATAAATACTAAGAAGAGGCTGGG + Intronic
1063844486 10:10110825-10110847 CTAAAAACAAAGAACAGGGCCGG - Intergenic
1064071567 10:12233440-12233462 CACAAAACACAGAAGGGGATAGG - Intronic
1064150887 10:12863677-12863699 AATAAAACACAAAAGAGGCTGGG - Intergenic
1064269697 10:13853670-13853692 CTAAAAATACAAAAGTAGCTGGG + Intronic
1064301614 10:14127858-14127880 CTCAAACCATAAAAGAGGCTGGG - Intronic
1064551323 10:16503699-16503721 CTAAAAATACAAAAATGGCTGGG - Intronic
1064577417 10:16760346-16760368 CTAAAAATACAAAAGTAGCTGGG + Intronic
1064637877 10:17387410-17387432 CTAAAAACACAAAATGAGCTGGG - Intronic
1064638711 10:17394186-17394208 CTAAAATCACAGAAGATACGTGG + Intronic
1064669277 10:17692881-17692903 CCAAAACCAGAAAAGAGGCTGGG - Intronic
1064702748 10:18038487-18038509 CTAAAAACACAAAATATGCCAGG + Intronic
1064746465 10:18483233-18483255 AAAAAAAAACAGAACAGGCTGGG + Intronic
1064998555 10:21317143-21317165 CTAAATACACAACAGAGGCCGGG - Intergenic
1065378619 10:25066857-25066879 CTAAAAATACAAAAGTGGCCAGG + Intergenic
1065495866 10:26327547-26327569 GAAAAATCACAGAAGAGGTTTGG - Intergenic
1065535587 10:26712160-26712182 CTAAAAACACAAAATTGGCTGGG - Intronic
1065550548 10:26864671-26864693 CTAAAAACACAAAATTAGCTGGG + Intergenic
1065886556 10:30082688-30082710 CTAAAAACACAAAATTGGCCGGG + Intronic
1065933741 10:30501918-30501940 GAAAAATCACAGAAGAAGCTGGG - Intergenic
1066109472 10:32183229-32183251 CAAAAAAAAAAGAAGAGGCTAGG + Intergenic
1066253223 10:33654187-33654209 CTAAAAAAAAAAAATAGGCTGGG + Intergenic
1066569189 10:36753072-36753094 CTAAAAACACAGTTGAGGCCGGG - Intergenic
1066976859 10:42377223-42377245 CTAAAAACACAAAATTAGCTGGG - Intergenic
1067012643 10:42728802-42728824 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1067039970 10:42944795-42944817 CTCAAAACACACTATAGGCTGGG + Intergenic
1067133073 10:43583921-43583943 CTAAAAACACAAAATTAGCTGGG - Intergenic
1067202167 10:44182486-44182508 CTAAAAATACAGAATTAGCTGGG + Intergenic
1067290828 10:44938562-44938584 CTAAAAATACAAAAATGGCTGGG - Intergenic
1067310948 10:45113066-45113088 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1067371258 10:45684890-45684912 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1067388525 10:45841261-45841283 CTAAAAATACAAAAGTAGCTGGG - Intronic
1067417539 10:46115699-46115721 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1067502954 10:46822582-46822604 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1067716421 10:48694336-48694358 ATAAAGCCACAGGAGAGGCTGGG - Intronic
1067838684 10:49658218-49658240 CTAAAAATACAAAAAAGGCCAGG + Intronic
1067915050 10:50388336-50388358 TTAAAAGCCCAAAAGAGGCTGGG + Intronic
1068279692 10:54853097-54853119 CTAAAAATACAAAAGTAGCTGGG + Intronic
1068738265 10:60439360-60439382 CAAATAACACATAATAGGCTGGG + Intronic
1068760406 10:60701961-60701983 CTAAAAACAAAAATTAGGCTGGG + Intronic
1069001569 10:63272410-63272432 CTAAAAACACAAAATTAGCTGGG - Intronic
1069455469 10:68550565-68550587 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1069474976 10:68723995-68724017 CTAAAAATACAAAACTGGCTGGG + Intronic
1069495104 10:68896753-68896775 CTAAAAATACAAAATAGGCCCGG - Intergenic
1069755550 10:70772573-70772595 CCAAATACAAAGAAGGGGCTGGG + Intronic
1069857329 10:71448539-71448561 CAAAAAGAAGAGAAGAGGCTGGG - Intronic
1070155769 10:73834211-73834233 CTTAAAACCCAGTAGAAGCTGGG - Intronic
1070846765 10:79529207-79529229 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1070927032 10:80231060-80231082 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1070971981 10:80574994-80575016 TTAAAAACTCACAAGAGGCCAGG - Intronic
1071050896 10:81448097-81448119 CTAAAAATACAAAATAAGCTGGG - Intergenic
1071144396 10:82550584-82550606 CTAAAAACACAAAGGAATCTTGG - Intronic
1071316130 10:84400464-84400486 GGAAAAAAACAAAAGAGGCTGGG - Intronic
1071503073 10:86217163-86217185 CTAAAATCACAGGGGAGCCTGGG + Intronic
1071556656 10:86608680-86608702 GTTAAAACACTGAGGAGGCTCGG - Intergenic
1071619701 10:87108208-87108230 CTAAAAACACAAAATTGGCCTGG - Intronic
1071687767 10:87779135-87779157 CTAAAAATACAAAATTGGCTGGG + Intronic
1071767407 10:88683396-88683418 ATAAAAATACAGATGAGGCCAGG + Intergenic
1071893130 10:90034285-90034307 TTAAAAACACAAACCAGGCTGGG + Intergenic
1071994235 10:91131101-91131123 CTGCAAACACACTAGAGGCTGGG + Intergenic
1072103432 10:92251024-92251046 GTAAAAATACAGTATAGGCTGGG - Intronic
1072114814 10:92360388-92360410 CTAAAAACACAAAATTAGCTGGG + Intergenic
1072354092 10:94588984-94589006 CTAAAAACACAAAATTAGCTAGG + Intronic
1072418128 10:95265901-95265923 CTAAAAAAACAAAACAGGCCAGG + Intronic
1072475133 10:95752494-95752516 CTAAAAACACAAAATTAGCTGGG + Intronic
1072558670 10:96547656-96547678 CTAAAAACACAAAATTAGCTGGG + Intronic
1072668257 10:97410257-97410279 CTAAAAATACAAAATAAGCTAGG + Intronic
1073145128 10:101275622-101275644 CTAAAAATACAAAAGTTGCTGGG + Intergenic
1073172189 10:101519832-101519854 CTAAAAATACAGAATTAGCTGGG + Intronic
1073224761 10:101908822-101908844 CTAAAAACACAGAATTAGCCGGG - Intronic
1073230261 10:101963430-101963452 CTAAAAATACAAAAATGGCTGGG - Intronic
1073238484 10:102037477-102037499 TTAAAAATCCAGAAGAGGCTAGG - Intronic
1073311176 10:102542918-102542940 CGAAAAAAGCAAAAGAGGCTGGG - Intronic
1073402149 10:103266564-103266586 ATAAAAACAAACAATAGGCTGGG - Intergenic
1073406476 10:103302323-103302345 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1073427121 10:103461888-103461910 CTAAAAATACAAAAATGGCTGGG + Intergenic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1073651813 10:105368670-105368692 CCAGAAACAGAGAAGAGGATAGG - Intergenic
1073809582 10:107137699-107137721 CTAAAAACACAAAATTAGCTGGG + Intronic
1073886466 10:108045018-108045040 GTAAACACTCAGAAGGGGCTGGG - Intergenic
1074067389 10:110029038-110029060 CTAAAAATACAAAAGTAGCTGGG - Intronic
1074165143 10:110868551-110868573 TTAAAAACACTGAGAAGGCTGGG + Intergenic
1074228945 10:111514716-111514738 ATAGATAGACAGAAGAGGCTGGG - Intergenic
1074335856 10:112574476-112574498 TTAAATACCCAGCAGAGGCTGGG + Intronic
1074358669 10:112807690-112807712 CTAAAAACACAAAATTAGCTGGG + Intronic
1074548668 10:114422987-114423009 CTAAAAATACAAAAGATGCATGG - Intergenic
1075051344 10:119184551-119184573 CTAAAAACACAAAATTAGCTGGG - Intergenic
1075073596 10:119335522-119335544 CTAAAAACACAAAATTAGCTAGG - Intronic
1075151308 10:119935163-119935185 TTTAAAAGACAAAAGAGGCTGGG + Intronic
1075585833 10:123657386-123657408 CTAAAAACACAAAATTAGCTGGG + Intergenic
1076391118 10:130103137-130103159 CTAAAAATACAGAATTAGCTGGG - Intergenic
1076878360 10:133228036-133228058 CTAAAAAAAAAAAAAAGGCTGGG - Intergenic
1076939701 10:133594142-133594164 CTAAAAATACAAAATTGGCTGGG - Intergenic
1077312533 11:1896704-1896726 CTAAGAACAGAAAGGAGGCTGGG - Intergenic
1077596193 11:3533800-3533822 TTAAAAAAGAAGAAGAGGCTGGG - Intergenic
1077854107 11:6104854-6104876 CTAAAAAGGAAGCAGAGGCTGGG + Intergenic
1078197022 11:9144626-9144648 CTAAAAACACAAAATTAGCTGGG + Intronic
1078201753 11:9189799-9189821 CTTAAAACACAAAATTGGCTGGG - Intronic
1078212040 11:9277626-9277648 CTAAAAACACAAAATTAGCTGGG + Intergenic
1078223845 11:9374392-9374414 CTAAAAACACAAAATTAGCTGGG - Intergenic
1078488412 11:11745779-11745801 CCAAAAAATAAGAAGAGGCTGGG + Intergenic
1079093368 11:17495697-17495719 CAAGAAACACAAAACAGGCTTGG + Intronic
1079112935 11:17615765-17615787 CTAAAAATACAAAATAAGCTGGG + Intronic
1079464890 11:20720500-20720522 ATAAGAACAGAAAAGAGGCTGGG - Intronic
1079557566 11:21779052-21779074 CTAAAAACACAGAAGAGTTGAGG - Intergenic
1079956531 11:26873183-26873205 CTAAAAACACAAAATTAGCTGGG + Intergenic
1080361428 11:31518265-31518287 CTAAAAATACAAAAGTGGATGGG - Intronic
1080472200 11:32557190-32557212 TTAAAAACACACAAAAGGCCAGG + Intergenic
1080776275 11:35389763-35389785 TTAAGAACAAAAAAGAGGCTGGG - Intronic
1081017558 11:37901739-37901761 CTAAACACACAGAAGTGTATTGG - Intergenic
1081412248 11:42773710-42773732 ATAAAAATACAAAACAGGCTTGG - Intergenic
1082018227 11:47508928-47508950 CTAAAAACACAAAATTAGCTGGG - Intronic
1082022906 11:47550108-47550130 TTAAAAACACAAAATTGGCTGGG - Intronic
1082072144 11:47947759-47947781 CTAAAAACAACAAACAGGCTGGG + Intergenic
1082076308 11:47978896-47978918 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1082262645 11:50089147-50089169 CTAAAAACACAAAATTAGCTGGG + Intergenic
1082777468 11:57258255-57258277 GTAAAAAAACAGCAGATGCTGGG - Intergenic
1083389387 11:62337057-62337079 CTAAAAACACAAAATTAGCTGGG - Intergenic
1083399725 11:62415234-62415256 CTAAAAATACAAAATTGGCTGGG - Intronic
1083441585 11:62680025-62680047 CTAAAAATACAAAAATGGCTAGG - Intergenic
1083454322 11:62768367-62768389 TTAAAAGCTCAGAAGAGGCGGGG - Intergenic
1083465213 11:62841021-62841043 CTAAAAATACAAAACAGGCCGGG + Intronic
1083653397 11:64217386-64217408 CTAAAAATACAAAAGTAGCTGGG + Intronic
1083695259 11:64438316-64438338 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
1083697803 11:64454234-64454256 TTAAGAATGCAGAAGAGGCTGGG + Intergenic
1083781383 11:64919948-64919970 ATAAAAAGAAAAAAGAGGCTTGG + Intronic
1083786959 11:64956003-64956025 CTAAAAATACAAAAAAGGCCCGG + Intronic
1083803847 11:65062079-65062101 CTAAAAACACAAAATTAGCTGGG - Intergenic
1083857225 11:65399292-65399314 CTCAAAACTGAGAAGAGGCTGGG - Intronic
1083866967 11:65460512-65460534 CTAAAAACACAGAAATGGTCTGG - Intergenic
1083964102 11:66032307-66032329 TTAAAAAAAGAAAAGAGGCTGGG - Intergenic
1084131536 11:67139538-67139560 CTAAAAAACAAAAAGAGGCTGGG - Intronic
1084135701 11:67179432-67179454 CTAAAAATACAAAATAAGCTGGG - Intronic
1084176854 11:67427254-67427276 CTAAAAACACAAAATTAGCTGGG - Intergenic
1084515626 11:69636844-69636866 GTGAACACACAGAAGGGGCTTGG + Intergenic
1084950898 11:72664965-72664987 CTAAAAATACAGAATTAGCTGGG - Intronic
1085092122 11:73725989-73726011 TTAAAAACACAAAAAAGGCCGGG + Intronic
1085122491 11:73976066-73976088 CAAAAAACAAACAAGAGGATGGG + Intronic
1085190585 11:74617693-74617715 TTTAAAACAAAGAAGAGGCCAGG - Intronic
1085330582 11:75646637-75646659 CTAAAAACACAAAATTAGCTGGG + Intronic
1085434437 11:76486980-76487002 TTAATAAGACAGATGAGGCTGGG + Intronic
1085722419 11:78924148-78924170 TTAAAAACAAAGAACAGGCTGGG - Intronic
1086043847 11:82509953-82509975 ATAGAAACATACAAGAGGCTGGG - Intergenic
1086165815 11:83776483-83776505 CAGAAAGCACCGAAGAGGCTGGG - Intronic
1086454393 11:86947040-86947062 CTAAAAATACAGAAGTAGCTGGG + Exonic
1086758765 11:90600707-90600729 CTAAAAACACAAAATTAGCTGGG + Intergenic
1086996176 11:93358876-93358898 TTAAAAAAAGAGAAGAGGCTGGG - Intronic
1087106687 11:94416548-94416570 AAAAAAACACAAAATAGGCTGGG + Exonic
1087194717 11:95293728-95293750 TTAAAAACAAAGAACAGGCCAGG - Intergenic
1087340034 11:96892816-96892838 CTAAAAATACAAAATAAGCTGGG + Intergenic
1087416388 11:97861456-97861478 CTAAAAACATGGAAGTGGTTTGG - Intergenic
1087766444 11:102160182-102160204 CTAAAAACACAGAATTAGCCAGG - Intronic
1088241563 11:107778531-107778553 CTAAAAACACAAAATTAGCTGGG + Intergenic
1088242463 11:107786251-107786273 TTTAAAACAAAGATGAGGCTGGG - Intergenic
1088249745 11:107852254-107852276 CTAAAAACACAATATTGGCTGGG + Intronic
1088263809 11:107970792-107970814 CTAAAAACACAAAATTAGCTGGG + Intergenic
1088488583 11:110365365-110365387 CTAAAAAAAAAGAACAGGCCGGG - Intergenic
1088511055 11:110575320-110575342 CTAAAAATACAAAATTGGCTGGG + Intergenic
1088535265 11:110853431-110853453 CTAAAAACACAGATGTGTGTTGG + Intergenic
1088658339 11:112023683-112023705 CTAAAAACACAAAATTAGCTGGG + Intergenic
1089029164 11:115305410-115305432 CTGAAAACACAGAAAAGGAGAGG - Intronic
1089265347 11:117255646-117255668 CTAAGAATACACAAGAGGCTGGG - Intronic
1089265352 11:117255706-117255728 CTAAGAATATACAAGAGGCTGGG - Intronic
1089716557 11:120365960-120365982 TTAAAAACAGAAAAGAGGCTGGG + Intronic
1089717126 11:120371325-120371347 CTAAAAATACAGAATTAGCTGGG + Intronic
1089804211 11:121068586-121068608 TTAAAAAAACAACAGAGGCTGGG + Intronic
1089906897 11:122049265-122049287 TTAAAAAAAGAGAAGAGGCCGGG - Intergenic
1090298128 11:125608485-125608507 CTAAAAATACAAAATTGGCTGGG - Intronic
1090758126 11:129813092-129813114 CTAAAAACACAAAATTAGCTGGG + Intergenic
1090765000 11:129868857-129868879 CTAAAAACACAAAATAAGCCGGG + Intronic
1091309777 11:134564080-134564102 CTAAAAACACAAAATTAGCTGGG - Intergenic
1091415306 12:277633-277655 CTAAATACAGAGAAGAGGTAAGG + Intergenic
1091576932 12:1746222-1746244 TTATAAACACTTAAGAGGCTGGG + Intronic
1091859620 12:3768392-3768414 CTAAAAACACAAAATTAGCTGGG + Intergenic
1092152175 12:6256903-6256925 CTAAAAACACAAAAGTAGCCGGG + Intergenic
1092178516 12:6427716-6427738 CTAAAAACACAAAATTAGCTGGG + Intergenic
1092324690 12:7517517-7517539 CTAAAAACACAAAATTAGCTGGG + Intergenic
1092339960 12:7667205-7667227 ATAAAAAAGCAGAAGTGGCTGGG - Intergenic
1092375867 12:7955101-7955123 CTAAAAATACAAAATTGGCTGGG + Intergenic
1092567535 12:9684562-9684584 ATAAAAACACACAATAGACTAGG - Intronic
1092691242 12:11112613-11112635 CTAAAAACACTCAAGAAACTAGG + Intronic
1092795321 12:12105601-12105623 ATAAAAACACAAATGAGGCCAGG + Intronic
1092847256 12:12595307-12595329 CTAAAAACACAAAATTAGCTGGG + Intergenic
1093000758 12:13993446-13993468 CCAAAAACAATGAATAGGCTGGG + Intergenic
1093250248 12:16793966-16793988 ATAAAGACACAGAATAGGTTAGG + Intergenic
1093251051 12:16805298-16805320 CAAAAAAGACAGCAAAGGCTCGG + Intergenic
1093462267 12:19417701-19417723 CAAAAAAAAAAAAAGAGGCTGGG - Intronic
1093504909 12:19853848-19853870 ATAAAAACACAGGTTAGGCTGGG - Intergenic
1093731985 12:22575375-22575397 CTAAAAACAGACAATAGGCCAGG + Intergenic
1094151392 12:27288041-27288063 CTAAAAATACAGAATTAGCTGGG - Intronic
1094312848 12:29104437-29104459 CTGAAAACACAAAAGAACCTTGG - Intergenic
1094364202 12:29662873-29662895 CAAAAAACACAAAAGAGAGTTGG + Intronic
1094554401 12:31484012-31484034 CTAAAAACACAAAATTAGCTGGG - Intronic
1095050675 12:37551534-37551556 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1095462340 12:42456094-42456116 CTAAAAATACAAAATAAGCTGGG + Intronic
1095751562 12:45718225-45718247 CTAAAGACACTGAAGTGGCCAGG + Intergenic
1095769702 12:45939535-45939557 CTAAAAATACAAAAGTAGCTGGG + Intronic
1095813659 12:46398154-46398176 CTAAAAACTCACAAGAAACTAGG + Intergenic
1095888196 12:47210602-47210624 CTAAAAATACAAAATTGGCTGGG + Intronic
1095981805 12:47978437-47978459 CTGAGAGGACAGAAGAGGCTGGG - Intronic
1096169667 12:49457592-49457614 CTAAAAATACAGAATTAGCTGGG - Intronic
1096293860 12:50366715-50366737 AAAAAAATACACAAGAGGCTGGG + Intronic
1096620139 12:52859261-52859283 CTAAAAACACAAAATTAGCTGGG + Intergenic
1096727071 12:53572944-53572966 CTAAAAACACAAAATTAGCTGGG - Intronic
1096819968 12:54226315-54226337 CTCAAAACAGAGAAGAGGGGTGG - Intergenic
1096852875 12:54453542-54453564 CTAAAGAAACAGAACTGGCTGGG + Intergenic
1097008906 12:55938641-55938663 CTTAAGAAACAGAAGAGGATGGG + Intronic
1097012142 12:55960840-55960862 TTAAAAACACAGAGAAGGCCGGG - Intronic
1097038780 12:56141935-56141957 CTAAAAATACAAAATTGGCTGGG + Intronic
1097229556 12:57501522-57501544 CTGAAAATACAGAAATGGCTAGG + Intronic
1097915899 12:65019985-65020007 CTGAAAACACACAAAAGGCCAGG - Intergenic
1098063239 12:66585022-66585044 ATAAAAAAACAAAAGAGGCAGGG - Intronic
1098083780 12:66818887-66818909 GTAAAAATAGAGAAGAGCCTTGG + Intergenic
1098228363 12:68347980-68348002 CTAAAAACACAAAATTAGCTGGG - Intergenic
1098427947 12:70387561-70387583 CTAAAAATACAAAATTGGCTGGG - Intronic
1098797932 12:74916410-74916432 CTAAAAACACAAAATTAGCTGGG + Intergenic
1098889021 12:75989567-75989589 CTAAAAACACAAAATTAGCTGGG + Intergenic
1098900331 12:76105515-76105537 CTAAAAACACAAAATTAGCTGGG - Intergenic
1098933982 12:76455692-76455714 CTATACAGACAAAAGAGGCTAGG + Intronic
1098934031 12:76456487-76456509 CTAAAAATACAAAATTGGCTGGG + Intronic
1098942906 12:76558850-76558872 TTAAAAGCACAGCAAAGGCTTGG + Intronic
1099082277 12:78200284-78200306 GTAAAAAGATAGAATAGGCTAGG + Intronic
1099475827 12:83106336-83106358 CTAAAAATACAAAATTGGCTGGG + Intronic
1099690259 12:85943086-85943108 CTAAAAATACAAAAGTAGCTAGG + Intergenic
1099707210 12:86171206-86171228 CTAAAAATACAAAATAAGCTGGG + Intronic
1100226024 12:92556514-92556536 CTAAAAAGTGATAAGAGGCTGGG - Intergenic
1100308703 12:93374994-93375016 CTAAAATGAGAGAATAGGCTGGG - Intergenic
1100322188 12:93506221-93506243 TTGAAGACTCAGAAGAGGCTGGG - Exonic
1100474012 12:94919023-94919045 CTAAAAATACAAAATAAGCTGGG - Intronic
1100546845 12:95611614-95611636 CTAAAAACACAAAATTAGCTGGG - Intergenic
1100569117 12:95829936-95829958 CTAATAACACTGAAGAGGGCAGG + Intergenic
1100580589 12:95935915-95935937 CTAAAAACACAAAATTAGCTGGG + Intronic
1100641192 12:96483886-96483908 CTAAAAACACAAAATTAGCTGGG - Intergenic
1100644166 12:96511477-96511499 CTAAAAACACAAAAGTAGCTGGG - Intronic
1101063358 12:100994581-100994603 ATAAAAACACAGAAAATGCAGGG - Intronic
1101132084 12:101699247-101699269 CTAAAAACACAAAAGTGAGTCGG - Intronic
1101230255 12:102733580-102733602 CTAAAAATACAAAAGAAGCCAGG + Intergenic
1101355447 12:103973244-103973266 CTAAAAACACAAAATTAGCTGGG - Intronic
1101591355 12:106128290-106128312 CTAAAAATACAAAATTGGCTGGG - Intronic
1101597670 12:106181290-106181312 TTAAAATCTCATAAGAGGCTGGG - Intergenic
1101662544 12:106778721-106778743 TCAAAAACACAGAAGAGACAGGG - Intronic
1101999913 12:109550933-109550955 CCAAAAACCTGGAAGAGGCTGGG - Intergenic
1102163303 12:110786571-110786593 CTAAAAACCCTGAAGAGGCCGGG + Intergenic
1102164986 12:110798941-110798963 AAAAAAACAAAGAAAAGGCTGGG - Intergenic
1102249890 12:111379527-111379549 CAAAAAAAAAAGAAGAGGCTGGG + Intergenic
1102258978 12:111431903-111431925 TTAAAGACAGAGAAGAGGCTGGG - Intronic
1102334308 12:112064871-112064893 CTAAAAATACAGAATTAGCTGGG + Intronic
1102873646 12:116433109-116433131 ACAAAAACAGAGAAGCGGCTGGG - Intergenic
1102875145 12:116443445-116443467 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1102929492 12:116851441-116851463 CTAAAAGCACACGAGAGGCCGGG + Exonic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1103089542 12:118087948-118087970 CGAAAGACCCAGATGAGGCTGGG + Intronic
1103118513 12:118360102-118360124 CTAAAAATACAAAAATGGCTGGG + Intronic
1103355449 12:120316481-120316503 CTAAAAATACAGAATTAGCTGGG + Intergenic
1103561733 12:121796426-121796448 CTGACAACACAGCAGTGGCTGGG - Intronic
1103575716 12:121875823-121875845 CCAAAAGCACAGATGAGGCTGGG + Intergenic
1103709979 12:122905273-122905295 TTAAAAATACAGCAGAGGCTGGG - Intergenic
1103777130 12:123374415-123374437 CTAAAAATACAGAATTAGCTGGG + Intergenic
1103789734 12:123461108-123461130 AAAAAAAGAAAGAAGAGGCTGGG - Intronic
1103995330 12:124826042-124826064 CTAAAAACAAAGAGGTGGCCGGG + Intronic
1105058791 12:133129338-133129360 CTAAAAATACAGAATTAGCTGGG + Intronic
1105333907 13:19445778-19445800 CTAAAAATACAAAAGTAGCTGGG + Intronic
1105366445 13:19769572-19769594 CTAAAAACACAAAATTAGCTGGG + Intronic
1105368916 13:19785830-19785852 CTAAAAATACAAAAAAGGCCGGG + Intergenic
1105756938 13:23474599-23474621 CTAAAAATACAGAATTAGCTGGG + Intergenic
1106013548 13:25847182-25847204 CTAGAAACACAGAACATTCTGGG + Intronic
1106114390 13:26804460-26804482 CTAAAAACACAAAATTAGCTTGG - Intergenic
1106158540 13:27179860-27179882 CTAAAAACACAAAATTAGCTGGG + Intergenic
1106192614 13:27466847-27466869 CTGAAAGCACAGCAAAGGCTGGG - Intergenic
1106255516 13:28019126-28019148 CTAAAAACACAAAATTAGCTGGG - Intronic
1106259957 13:28057742-28057764 CTAAAAACACACAGGAGGCCGGG + Intronic
1106521165 13:30498941-30498963 AAAAAAACAAAAAAGAGGCTGGG - Intronic
1106621970 13:31379055-31379077 CTAAAAACACAAAATTAGCTGGG + Intergenic
1106626628 13:31427286-31427308 CTTAGAACACAGAAGAGCCTGGG - Intergenic
1106669800 13:31892426-31892448 TTAATAGCACAGAAGAGGCCGGG + Intergenic
1106783072 13:33079302-33079324 TTAAAAACACAGAGCAGGCTGGG + Intergenic
1107907164 13:45071898-45071920 ATAATAATAAAGAAGAGGCTGGG - Intergenic
1107925199 13:45253778-45253800 ATAAAAAGAAAGAAGAGGCTGGG + Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108289413 13:48943713-48943735 CTAAAAATACAAAATTGGCTGGG + Intergenic
1108405415 13:50096124-50096146 CTAAAAACACAAAATTAGCTGGG - Intronic
1109063771 13:57656801-57656823 CTGACAACACAGAAGAGAATGGG + Intronic
1109166946 13:59047256-59047278 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1109272754 13:60272666-60272688 CTAAAAACACAAAATTAGCTGGG - Intergenic
1110010597 13:70328139-70328161 CTAAAAACACTCAATAAGCTAGG - Intergenic
1110027110 13:70554446-70554468 CTAAAAACACAAAATTTGCTGGG - Intergenic
1110423879 13:75343675-75343697 CTAAAAATACAAAAGTAGCTGGG - Intronic
1110669212 13:78156437-78156459 CTAAAAATACAAAATTGGCTGGG + Intergenic
1110781156 13:79466551-79466573 CTAAAAATACAAAATTGGCTGGG - Intergenic
1110847769 13:80209057-80209079 CTAAAAACACAAAATTAGCTGGG - Intergenic
1110915332 13:81014137-81014159 CTAAAAACACAAAATTGGTTGGG - Intergenic
1110944707 13:81397625-81397647 CTAAAAATACAGAATTAGCTGGG + Intergenic
1111510714 13:89258285-89258307 ATAAAAACACACCAGAGACTGGG - Intergenic
1111591544 13:90353818-90353840 CTAAAAATACAGAATTAGCTGGG + Intergenic
1111609623 13:90586988-90587010 TTAAAAACACACCTGAGGCTAGG + Intergenic
1111619518 13:90705751-90705773 ATAAAAACACTCAACAGGCTGGG + Intergenic
1111817363 13:93170311-93170333 GTCAAACCACAGAAGAGGCCAGG - Intergenic
1112265581 13:97920377-97920399 CTATTAACACAGGTGAGGCTGGG - Intergenic
1112432717 13:99366273-99366295 CACAAAACACACAAGAGACTGGG - Intronic
1112758207 13:102663907-102663929 CTAAACTCACAGTAGTGGCTAGG - Intronic
1112871385 13:103975089-103975111 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1113141597 13:107158262-107158284 CTAAAAATACAGAATTAGCTGGG + Intergenic
1113491302 13:110694185-110694207 CTAAAAATACAGAATTAGCTGGG - Intronic
1114253881 14:20985370-20985392 CTAAAAACAAAAAAGAAGCTGGG + Intergenic
1114281416 14:21195688-21195710 CTAAACACACTGAACAGGCTCGG + Intergenic
1114310015 14:21457827-21457849 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1114448645 14:22809634-22809656 CTAAAAATACAAAAAAGGCCGGG - Intronic
1114487752 14:23073495-23073517 CTAAAAACACAAAATTGGCTGGG + Intronic
1114725983 14:24938146-24938168 TGAAAAACACAGAATATGCTGGG + Intronic
1114864728 14:26574957-26574979 ATAAAAAGACAGTATAGGCTGGG - Intronic
1115114922 14:29869145-29869167 TTAAAAAAGAAGAAGAGGCTGGG + Intronic
1115636975 14:35299319-35299341 CAAAAAAAAAAAAAGAGGCTGGG - Intronic
1115653721 14:35422929-35422951 CAAAAAAGAAAGAAAAGGCTGGG - Intergenic
1115769505 14:36655549-36655571 ATAAGAACACAGAAGACACTTGG - Intergenic
1115925115 14:38424531-38424553 CTATCAACAAAGAAGAGCCTGGG - Intergenic
1115943220 14:38631469-38631491 CTAAAAAGACAGAAGAGACTGGG + Intergenic
1115982222 14:39065835-39065857 CTAAAAACACAAAATTAGCTGGG + Intronic
1116048553 14:39775343-39775365 ACAGAAACACAAAAGAGGCTGGG - Intergenic
1116237203 14:42295066-42295088 CTAAAAACCCTCAACAGGCTAGG - Intergenic
1116421958 14:44743577-44743599 CCAAAAACACAAGACAGGCTGGG - Intergenic
1116475408 14:45333434-45333456 TTAAAAAAACAAAATAGGCTGGG - Intergenic
1116589584 14:46754433-46754455 CTTAAAACACAAAACAGGATGGG + Intergenic
1116607082 14:47013954-47013976 CTAAAAACACAAAATTAGCTAGG - Intronic
1116805182 14:49487520-49487542 CTCTAATTACAGAAGAGGCTAGG - Intergenic
1116895061 14:50308227-50308249 CTAAAAAGACAAAATTGGCTGGG + Intronic
1116925825 14:50635868-50635890 CTAAAAATACAGAAGTAGCTGGG - Intronic
1117099597 14:52332991-52333013 TTGAAAACACAGAAGAGGCCGGG - Intergenic
1117246006 14:53887305-53887327 CTAAAAACACAAAATTAGCTGGG + Intergenic
1117361014 14:54974124-54974146 CTAAAAAGACAAAAGTGGCTGGG + Intronic
1117501986 14:56361769-56361791 CTAAAAACACTCAATAAGCTAGG - Intergenic
1117600457 14:57368551-57368573 CTAAAAACACTCAATAAGCTAGG + Intergenic
1117916764 14:60685834-60685856 CTAAAAACACAAAATTAGCTGGG + Intergenic
1118082450 14:62376532-62376554 TCAGAAACAAAGAAGAGGCTGGG - Intergenic
1118191554 14:63585237-63585259 CTAAACATACAGAAGGGGCCGGG - Intergenic
1118230365 14:63942654-63942676 CTAAAAATACAAAATTGGCTGGG - Intronic
1118232314 14:63964683-63964705 CTAAAAACACAAAATTAGCTGGG - Intronic
1118287041 14:64484518-64484540 CTAAAAACACAAAATTAGCTGGG + Exonic
1118354708 14:65003616-65003638 CTAAAAACAGAGAAGATTGTGGG + Intronic
1118359803 14:65046135-65046157 CTAAAAATACAAAATTGGCTGGG - Intronic
1118458507 14:65966698-65966720 CTGATAACACAGAAGAGCCCTGG + Intronic
1118553633 14:66986857-66986879 CTAAGAAGGCAGAAGAGGCAAGG - Intronic
1119083554 14:71719652-71719674 CTAAAAACACAAAAATAGCTGGG - Intronic
1119288005 14:73471677-73471699 TCAAAAACACTGAACAGGCTGGG - Intergenic
1119316215 14:73697445-73697467 CTAAATACAAACAAGAGGCCAGG + Exonic
1119516676 14:75253946-75253968 CTAAAAACACAAAATTAGCTGGG - Intronic
1119553088 14:75530807-75530829 TTAAAAACACAGAAGGGGCTGGG - Intronic
1119594559 14:75922413-75922435 CTAAAAACACTCAATAAGCTAGG - Intronic
1119597237 14:75946590-75946612 CTGAACACACAGAAGATGCTTGG - Intronic
1119796367 14:77401398-77401420 CAAAAGACTCAGAACAGGCTGGG + Intronic
1119843333 14:77809737-77809759 TTAAAATCACAAGAGAGGCTGGG + Intronic
1120108829 14:80528447-80528469 CTAAAAACACAAAATTAGCTGGG - Intronic
1120137635 14:80888590-80888612 CTAAAAACACTCAAGAAACTAGG + Intronic
1120160449 14:81139824-81139846 TTAAAAGCACAGCAGTGGCTTGG - Exonic
1120199793 14:81524574-81524596 TTAAAAACAAAGGAGGGGCTGGG + Intronic
1120425713 14:84345246-84345268 CTAAAAACACAAAATTAGCTGGG - Intergenic
1120445346 14:84588145-84588167 CTAAAAACACAAAATTAGCTGGG - Intergenic
1120568561 14:86089963-86089985 CTACAAACCCAGAAAAGGCCTGG - Intergenic
1120752660 14:88212277-88212299 CTAAAAATACAGAATTAGCTGGG + Intronic
1120795628 14:88630189-88630211 CTAAAAATACAGAATTAGCTAGG - Intronic
1120924931 14:89788322-89788344 CTAAAAATACAGAATTAGCTGGG + Intergenic
1120924956 14:89788456-89788478 CTAAAAATACAGAATTAGCTGGG + Intergenic
1120986028 14:90335796-90335818 TAAAAAACAAACAAGAGGCTGGG + Intergenic
1121054350 14:90840577-90840599 TTATAATCACAGCAGAGGCTGGG - Intergenic
1121071880 14:91030906-91030928 TTAAAAACACAGAATAATCTTGG + Intronic
1121249713 14:92490437-92490459 CTAGAAGCACATCAGAGGCTGGG - Intronic
1121346882 14:93142775-93142797 CTAAAAACACAAAAGATGAAAGG + Intergenic
1121910934 14:97791839-97791861 CTAAAAATACAGAATTAGCTGGG + Intergenic
1122093029 14:99352598-99352620 CTAAAAACACAAAATTAGCTGGG - Intergenic
1122103392 14:99431649-99431671 CTAAAAATACAAAATTGGCTGGG - Intronic
1122290267 14:100677038-100677060 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1122488796 14:102099261-102099283 TTAAAAATGCAGGAGAGGCTGGG + Intronic
1122539265 14:102488137-102488159 ATAAAAATGCAAAAGAGGCTGGG - Intronic
1122564276 14:102640956-102640978 AGAAAAACAGAAAAGAGGCTGGG + Intronic
1122731347 14:103801009-103801031 CTAAAAATACAGAATTAGCTGGG - Intronic
1122750684 14:103930346-103930368 CTAAAAATACAAAATAAGCTGGG - Intronic
1202840468 14_GL000009v2_random:116313-116335 CTAAAAACACAAAATTAGCTGGG + Intergenic
1202909849 14_GL000194v1_random:106510-106532 CTAAAAACACAAAATTAGCTGGG + Intergenic
1202873657 14_GL000225v1_random:188715-188737 CTAAAAATACAAAATTGGCTGGG + Intergenic
1202891518 14_KI270722v1_random:163554-163576 CTAAAAATACAAAAAAAGCTGGG + Intergenic
1123469945 15:20542340-20542362 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1123648110 15:22458341-22458363 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1123703452 15:22933128-22933150 TTAAAAAAAAAGAAGAGGGTGGG - Intronic
1123730239 15:23137362-23137384 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1123748377 15:23334772-23334794 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1123885213 15:24719337-24719359 CTAGAAAGAGAGAAGATGCTGGG - Intergenic
1124107727 15:26756272-26756294 TTAAATATACAGAACAGGCTGGG + Intronic
1124252962 15:28119104-28119126 CTAAAAATACAAAAAAGGCTGGG + Intronic
1124280755 15:28358659-28358681 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1124301949 15:28552970-28552992 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1125335475 15:38622358-38622380 CTAAAAAAAGATAAGAGACTTGG + Intergenic
1125840000 15:42791311-42791333 TTAAAAACAGAGAACTGGCTGGG - Intronic
1125904568 15:43379120-43379142 TTAAAAACTCTGAAGAGCCTTGG - Intronic
1126042109 15:44601546-44601568 AAAAAAAAAAAGAAGAGGCTGGG - Intronic
1126120540 15:45247633-45247655 CTAAAAATACAAAATAAGCTGGG - Intergenic
1126125078 15:45288161-45288183 CTGAAAGCAGAGAAGAGTCTGGG - Intergenic
1126355003 15:47786134-47786156 TGAAAAACACAGAATAGGCCAGG + Intergenic
1126578145 15:50217758-50217780 CTCAAAAAACAGAAGAGGCCAGG + Intronic
1126650773 15:50919369-50919391 CTAAAAATACAGAATTAGCTGGG + Intronic
1126750309 15:51870232-51870254 TTAAAAACACAGCTGTGGCTGGG - Intronic
1126768535 15:52032843-52032865 CTAAAAATACAGAATTAGCTGGG - Intronic
1126799687 15:52287813-52287835 CTAAAAATACAAAAGTAGCTGGG + Intronic
1127086865 15:55432114-55432136 CTAAAAACACAAAATTAGCTTGG - Intronic
1127110114 15:55659756-55659778 CTAAAAACACAAAATTAGCTGGG + Intronic
1127184089 15:56459827-56459849 CTAAAAATACAGAATTAGCTGGG + Intronic
1127364645 15:58276559-58276581 CTAAAAACACAAAAGTAGCTGGG - Intronic
1127446264 15:59066447-59066469 CTAAAAATACAAAATAAGCTGGG + Intronic
1127466838 15:59252417-59252439 CTAAAAATGCAAAAGAGGCTGGG + Intronic
1127521863 15:59750930-59750952 CTAAAAACACAAAATTAGCTGGG + Intergenic
1127788455 15:62377179-62377201 CTAAAAACAAACAAAAGGCCGGG + Intergenic
1128031161 15:64481479-64481501 CTAAAAATACAGAATTAGCTAGG - Intronic
1128056988 15:64707178-64707200 CTTAAAAAACAAAAGAGGCCGGG + Intergenic
1128066680 15:64769262-64769284 CTAAAAATACAGAATTAGCTGGG + Intronic
1128204512 15:65838868-65838890 CTAAAAATACAGAATTAGCTAGG - Intronic
1128507655 15:68287425-68287447 CTACCTACAGAGAAGAGGCTAGG - Intronic
1128965852 15:72056812-72056834 CTAAAAATACAAAAATGGCTGGG + Intronic
1129347160 15:74929782-74929804 CTAAAAACTAAGAATAGGCCAGG + Intronic
1129349712 15:74948375-74948397 CTTAAAACCCAGAGGAGGCCGGG + Intergenic
1129437141 15:75550624-75550646 CTAAAAACACAAAATTAGCTGGG + Intronic
1129459095 15:75691011-75691033 CTAAAAACACAAAATTAGCTGGG + Intronic
1129640905 15:77377087-77377109 CTAAACACAGATAAGGGGCTGGG + Intronic
1129785264 15:78305797-78305819 TTAAAATTACAGAACAGGCTGGG - Intergenic
1129860499 15:78856957-78856979 TTAAAAAAAAAAAAGAGGCTGGG + Intronic
1130009774 15:80141738-80141760 CTAAAAACACAAAATTAGCTGGG - Intergenic
1130121915 15:81057623-81057645 CTAAAAATACAAAATTGGCTGGG - Intronic
1130401032 15:83554346-83554368 CTAAAAACACAAAATTAGCTGGG - Intronic
1130644499 15:85712127-85712149 ATTAAAACACAGACCAGGCTGGG - Intronic
1130954167 15:88615157-88615179 GAAAAAACACAGACGAGGCCGGG - Intergenic
1131246713 15:90800517-90800539 CTAAAAATACAAAATAAGCTGGG + Intronic
1131346514 15:91654383-91654405 CTAAAAACACAAAAATAGCTGGG + Intergenic
1131626804 15:94128986-94129008 CTAAAAACACAAAAGTAGCCAGG - Intergenic
1132174170 15:99695696-99695718 CTAAAAATACAGAATTAGCTGGG + Intronic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1132818674 16:1849255-1849277 CTAAAAATACAAAAAAGGCTGGG + Intronic
1133068158 16:3225282-3225304 CTAAAAATACAAAATAAGCTGGG + Intronic
1133252505 16:4492740-4492762 CAAAAAACACAAAAAAGGCTGGG + Intronic
1133274503 16:4628838-4628860 AAAAAAAAACAGAAAAGGCTGGG - Intronic
1133300044 16:4776821-4776843 CTAAAAACACAAAATTAGCTGGG + Intergenic
1133307412 16:4819306-4819328 CTAAAAAAAGAAAAAAGGCTGGG - Intronic
1133338892 16:5024048-5024070 CTAAAAATACAAAACAGGCATGG - Intergenic
1133355554 16:5134056-5134078 CTAAAAACACAAAATTAGCTGGG + Intergenic
1133390082 16:5403187-5403209 CTAAAAACACAAAATTAGCTGGG + Intergenic
1133595997 16:7293410-7293432 TTAAAAACACAGACAAGGATCGG - Intronic
1133958116 16:10464989-10465011 CTAAAAACACAAAATTAGCTGGG - Intronic
1133988359 16:10685456-10685478 CTAAAAACACAAAATTAGCTGGG - Intronic
1134130463 16:11646146-11646168 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
1134225236 16:12385007-12385029 CTAAAAATACAAAAGTAGCTGGG + Intronic
1134409258 16:13989750-13989772 CTAAAAACACAAAATTAGCTGGG + Intergenic
1134539265 16:15051676-15051698 TTAAAAATAAAGTAGAGGCTGGG - Intronic
1134653277 16:15927491-15927513 CTAAAAACACAAAATTAGCTGGG - Intergenic
1134883514 16:17769402-17769424 TTAAAAACACTGAATGGGCTGGG + Intergenic
1134903484 16:17959619-17959641 CTCAGGAGACAGAAGAGGCTAGG + Intergenic
1135080751 16:19432622-19432644 CTAAACCCACAGAAAAGGATTGG - Intronic
1135323318 16:21511137-21511159 CTAAAAACACAAAATTAGCTGGG + Intergenic
1135346356 16:21692029-21692051 TTAAAATGAGAGAAGAGGCTGGG + Intronic
1135675490 16:24411646-24411668 CTAAAAACACAAAATTAGCTGGG - Intergenic
1135729205 16:24880493-24880515 CTAAAAACACAAAATTAGCTGGG - Intronic
1135734952 16:24923467-24923489 TTAAAAAAACAAAATAGGCTGGG + Intronic
1135746193 16:25018591-25018613 CAAAAAAGACTGAAGAGGCCAGG + Intergenic
1135786820 16:25357760-25357782 CTAAAAACATGGAAGCGGCCTGG + Intergenic
1135922088 16:26660110-26660132 CTAAAAATACAAAATTGGCTGGG - Intergenic
1136102332 16:28005272-28005294 CTAAAAATACAGAATTAGCTGGG - Intronic
1136174981 16:28510434-28510456 CTAAAAATACAGACCAAGCTCGG - Intronic
1136334804 16:29604324-29604346 CTAAAAACACAAAATTAGCTGGG + Intergenic
1136348017 16:29689074-29689096 TTAAAAACAAACAAAAGGCTGGG - Intronic
1136487203 16:30581162-30581184 CTCAAAAAAAAAAAGAGGCTGGG + Exonic
1137266420 16:46872656-46872678 TCAAAAACAAAGAAGAGACTGGG + Intergenic
1137293095 16:47065623-47065645 CTAATAACACACAAGAGGAATGG - Intergenic
1137668997 16:50268398-50268420 TTAAAAAAAGAAAAGAGGCTGGG - Intronic
1137773384 16:51036345-51036367 TTAAAAACACAAAACAGGCCGGG - Intergenic
1137827992 16:51516458-51516480 CTAAAAACACAAAATTAGCTGGG - Intergenic
1137944452 16:52720358-52720380 CAAAATACACACATGAGGCTGGG - Intergenic
1138058469 16:53861954-53861976 CTTAAAACTCTGTAGAGGCTGGG + Intronic
1138517898 16:57547740-57547762 CAAAAAACAAAAAACAGGCTGGG - Intronic
1138571552 16:57877124-57877146 CTAAAAACAAAGTAGAGACGAGG + Intergenic
1138673409 16:58633341-58633363 TTAAAAAAAAAAAAGAGGCTGGG - Intergenic
1139111973 16:63903126-63903148 CAAAAAAAACAGAAAAGGCCAGG - Intergenic
1139398363 16:66659082-66659104 TTAAAATCACACTAGAGGCTGGG + Intronic
1139445914 16:66998571-66998593 CTAAAGAAAGAGAGGAGGCTGGG + Intronic
1139498886 16:67344110-67344132 ATAAAATCACAGATGTGGCTGGG - Intronic
1139637657 16:68267909-68267931 CTATAAAAACCCAAGAGGCTGGG + Intronic
1139702393 16:68716105-68716127 CTAAAAATACAAAATTGGCTGGG + Intronic
1139837948 16:69854844-69854866 TAAAAAACAAAAAAGAGGCTAGG - Intronic
1139874253 16:70132782-70132804 CTAAACACACACAAAGGGCTAGG - Intronic
1140401716 16:74677346-74677368 CAAAAAATAAAAAAGAGGCTGGG - Intronic
1140640748 16:76969419-76969441 CTTAAAAAACAAAAGAGGCCTGG - Intergenic
1140858396 16:78998035-78998057 CTAAAAACACAAAATTAGCTAGG - Intronic
1141095768 16:81161937-81161959 CTAAAAACACAAAACTGGCTGGG - Intergenic
1141407917 16:83809628-83809650 CTAAAAATACAAAATTGGCTGGG - Intronic
1141592932 16:85080631-85080653 CTAAAAATACAAAATAAGCTGGG + Intronic
1141599635 16:85117638-85117660 CTAAAAACACAAAATTAGCTGGG + Intergenic
1142035517 16:87860170-87860192 CTAAAAACACAAAATTAGCTGGG + Intronic
1142428380 16:90012618-90012640 CTAAAAATACAGAATTAGCTGGG - Intronic
1142477233 17:196054-196076 CTAAAAACTCTAAATAGGCTGGG + Intergenic
1142479689 17:211442-211464 CTAAAAATACAGAATTAGCTGGG + Intergenic
1142695607 17:1631204-1631226 CTAAAAATACAAAAATGGCTGGG + Intergenic
1142725015 17:1807049-1807071 CTAAAAATACAGAATAAGCTGGG - Intronic
1142891138 17:2943852-2943874 TCAAAACCACAGAAGAGGCCAGG + Intronic
1142893702 17:2961217-2961239 CAAAAAAAAAAGAAGAGGCTGGG + Intronic
1142969073 17:3599076-3599098 CTAAAAATACAGAATTAGCTGGG + Intergenic
1143139007 17:4730198-4730220 CTAAAAATACAGAATTAGCTGGG - Intergenic
1143372346 17:6448120-6448142 CTAAAAATACAAAATTGGCTGGG + Intronic
1143468871 17:7158741-7158763 CTAAAAATACAAAATTGGCTGGG - Intergenic
1143647867 17:8243356-8243378 CTAAAAACACAAAATTAGCTGGG + Intronic
1143892212 17:10111237-10111259 CTAAAAATACAGAAATGGCCAGG + Intronic
1143894455 17:10125354-10125376 CTAAAAACACAAAATTAGCTGGG + Intronic
1144291482 17:13830764-13830786 CTAAAAATACAAAATTGGCTGGG + Intergenic
1144476233 17:15591448-15591470 CTAAAAACACAAAATGAGCTGGG - Intronic
1144548710 17:16220646-16220668 CTAAAAATACAAAATTGGCTGGG - Intronic
1144567591 17:16372870-16372892 CTCAAAAAAAAGAACAGGCTGGG - Intergenic
1144709700 17:17393429-17393451 CAAAAAACACACAACAGGCCGGG + Intergenic
1144804505 17:17955632-17955654 AAAACAACAAAGAAGAGGCTGGG - Intronic
1144922021 17:18771944-18771966 CTAAAAACACAAAATGAGCTGGG + Intronic
1145401114 17:22533859-22533881 ATAAAAACACAGTAAAGGGTGGG + Intergenic
1145740034 17:27266062-27266084 CTAAAAAGTCAGGATAGGCTGGG - Intergenic
1145763491 17:27441732-27441754 CTAAAAATACAAAATAAGCTGGG + Intergenic
1145776107 17:27530163-27530185 CTAAAGACCCAGCAGGGGCTGGG + Intronic
1146039803 17:29440868-29440890 ATAAAAACACTCAACAGGCTGGG - Intronic
1146127697 17:30241679-30241701 GTAAGCACACAGAAGAGACTGGG + Intergenic
1146286997 17:31580944-31580966 CTCAGAACACTCAAGAGGCTTGG + Intergenic
1146391191 17:32424733-32424755 CTAAAAATACAGAATTAGCTGGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146576565 17:33998017-33998039 CTCAGAACAAAGAAGAGCCTGGG - Intronic
1146802082 17:35832993-35833015 CTAAAAACACAGAAGTTACCTGG + Intronic
1147117975 17:38316645-38316667 CTAAAAATACAAAAAAAGCTGGG + Intronic
1147173692 17:38637486-38637508 CTAAAAACAAAGAAGGAACTGGG + Intergenic
1147209940 17:38867166-38867188 CTAAAAAAAAAAAAAAGGCTAGG - Intergenic
1147226955 17:38986652-38986674 CTAAAAACACAAAATTAGCTAGG + Intergenic
1147287280 17:39412387-39412409 CTAAAAATACAGAATTAGCTGGG - Intronic
1147300270 17:39521004-39521026 CTAAAAACACAAAATTAGCTGGG - Intronic
1147356238 17:39899821-39899843 CTAAAAATACAGAATTAGCTGGG - Intergenic
1147364554 17:39951708-39951730 CTAAAAACACAAAATTAGCTAGG - Intergenic
1147659503 17:42109890-42109912 CAAAAAAAAAAAAAGAGGCTGGG + Intronic
1147794424 17:43032536-43032558 CTAAAAATACAAAAATGGCTGGG - Intergenic
1147932228 17:43989077-43989099 TAAAAAACACATAACAGGCTGGG + Intronic
1147943904 17:44069475-44069497 CTAAAAACACAAAATTAGCTGGG - Intergenic
1148002355 17:44397330-44397352 TTAGAAACACAGAAGAGGGAGGG + Intronic
1148011111 17:44482276-44482298 CTTAAAACCTAGACGAGGCTGGG + Intronic
1148077057 17:44943393-44943415 TTAAAAAAACAAAAGAGGCCAGG - Intronic
1148121538 17:45215295-45215317 CTAAAAACACAAAATTAGCTGGG - Intergenic
1148176362 17:45569130-45569152 CTAAAAAAATAAAAGAGGCCTGG + Intergenic
1148295017 17:46493830-46493852 CTAAAAAAATAAAAGAGGCCTGG - Intergenic
1148501123 17:48092149-48092171 CTAAAAATACAAAAGTAGCTGGG - Intronic
1148532300 17:48405969-48405991 CTAAAAACAGAATACAGGCTGGG + Intronic
1148608750 17:48949775-48949797 CTAAAAATACAGAATTAGCTGGG - Intergenic
1148674536 17:49437754-49437776 CTAAAAACACAAAATAAGTTGGG - Intronic
1149004991 17:51796209-51796231 CTAAAAAAAAAGAACAGGATTGG - Intronic
1149022987 17:51991646-51991668 CTAAAAACACAAAATTAGCTGGG + Intronic
1149061509 17:52428088-52428110 CTAAAAATACAAAATTGGCTGGG + Intergenic
1149127328 17:53251346-53251368 TTAACAACATAGATGAGGCTGGG - Intergenic
1149201933 17:54196512-54196534 CTAAAAACACAAAATTAGCTGGG + Intergenic
1149326003 17:55530487-55530509 TTAAAAATGCAGGAGAGGCTGGG + Intergenic
1149699939 17:58647059-58647081 CTAAAAACATAAAATAGGCATGG - Intronic
1149824385 17:59814139-59814161 CTAAAAATACAGAATTAGCTGGG - Intronic
1150067519 17:62124006-62124028 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1150216288 17:63472315-63472337 ATAAAAAGAAAGAAGAGGCTGGG + Intergenic
1150240652 17:63629418-63629440 TTAAAAACAAATAACAGGCTGGG - Intronic
1150408468 17:64922385-64922407 CTAAAAATACAAAAAAAGCTGGG - Intergenic
1150536562 17:66048768-66048790 CTAAAAATACAGAATTAGCTGGG - Intronic
1150740885 17:67778318-67778340 CTAAAAATACAAAAGTGGCCGGG + Intergenic
1150767225 17:68011731-68011753 ACAAAAACAGTGAAGAGGCTGGG - Intergenic
1150799553 17:68269832-68269854 CTAAAAATACAAAAGTAGCTGGG - Intronic
1150913093 17:69409689-69409711 CTAAAAATACAAAATAAGCTGGG + Intergenic
1151403814 17:73873966-73873988 ATAAAAACACACACGAGACTGGG - Intergenic
1151578286 17:74963636-74963658 CCCAAATCCCAGAAGAGGCTTGG + Intronic
1151592599 17:75055670-75055692 CTAAAAATACAAAAGTAGCTGGG + Intronic
1151621573 17:75248623-75248645 CTAAAAATACAGAATTAGCTGGG + Intronic
1151621905 17:75250918-75250940 CTAAAAACACAAAATTAGCTGGG + Intronic
1151632777 17:75322209-75322231 CTAAAAATACAAAAGTAGCTGGG + Intronic
1151677896 17:75609025-75609047 CTAAAAATACAAAAAAGGCCAGG - Intergenic
1151718147 17:75842040-75842062 CTAAAAATACAAAAAAGGCCGGG - Intronic
1151813725 17:76460594-76460616 TTAAAAAGCCAAAAGAGGCTGGG - Intronic
1151832111 17:76559375-76559397 CTAAAAACACAAAATTAGCTAGG - Intergenic
1151943908 17:77309024-77309046 CCAGAAACACAGCAGCGGCTGGG - Intronic
1152043471 17:77920284-77920306 ATTAAAAAAAAGAAGAGGCTGGG + Intergenic
1152043495 17:77920418-77920440 CTAAAAATACAGATGTGGCCAGG + Intergenic
1152051383 17:77981235-77981257 ATAAAAACCCAAAAGGGGCTAGG - Intergenic
1152087349 17:78228446-78228468 AAAAAAAAAAAGAAGAGGCTTGG + Intergenic
1152115097 17:78381137-78381159 CAAAAAACAAAAAAGTGGCTGGG - Intronic
1152213595 17:79018773-79018795 CTAAAAACACACAAGATGATGGG - Intergenic
1152367316 17:79863876-79863898 TTAAAATCACAAAAGAGGCCAGG - Intergenic
1152404986 17:80092607-80092629 CTAAAAAAAGAGAACAGACTGGG - Intronic
1152441153 17:80310711-80310733 CTAAAAATACAGAATTAGCTGGG - Intronic
1153372424 18:4334075-4334097 CTAAAAACACAAAATTAGCTGGG + Intronic
1153848616 18:9072157-9072179 CTAAAATGTCAGAAGGGGCTGGG - Intergenic
1153874198 18:9351939-9351961 CTAAAAACAGTGAACAGGCTGGG - Intronic
1154222394 18:12467786-12467808 CTAAAAATACAAAATAAGCTGGG + Intronic
1154481384 18:14829616-14829638 CCAAAAACACAGAAGACATTGGG + Intronic
1154991628 18:21602617-21602639 TTAAAAACAAAAACGAGGCTGGG + Intergenic
1155780788 18:29831949-29831971 CTAAAAACACAAAATTAGCTGGG + Intergenic
1155913669 18:31534669-31534691 CTAAAAACACAAAAAATGCCGGG - Intronic
1156180349 18:34596512-34596534 ATAAAAACAGTAAAGAGGCTGGG - Intronic
1156389763 18:36639375-36639397 CTAAAAATACAAAAAAGGCAGGG + Intronic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1156652141 18:39236876-39236898 CTAAAAACAGAGAATTGGCTGGG - Intergenic
1157535573 18:48454982-48455004 CTTAAAACACAGCACTGGCTTGG - Intergenic
1158009929 18:52716901-52716923 TTAAAAACAGGGAAGAGGATGGG + Intronic
1158448061 18:57538206-57538228 CTACAAAGACAGAGGTGGCTGGG + Intergenic
1158459537 18:57634094-57634116 CTAAAAATACAAAATAAGCTGGG - Intergenic
1158536511 18:58312839-58312861 CTAAAAACACAAAATTAGCTGGG - Intronic
1158578751 18:58662863-58662885 CCAAAAATATAGAAGAAGCTGGG + Intergenic
1158585449 18:58729326-58729348 CTAAAAATACAAAATTGGCTGGG + Intronic
1158710000 18:59829080-59829102 ATAAAAACTCAGGAGAGCCTGGG - Intergenic
1158901716 18:61968023-61968045 CTAAAAACACAAAATTAGCTGGG + Intergenic
1159149342 18:64500677-64500699 TTAAAAATACAGAATAGGATGGG + Intergenic
1159468022 18:68811323-68811345 TGACAAACACATAAGAGGCTGGG + Intronic
1160207128 18:76843880-76843902 ATAAAAGTAAAGAAGAGGCTGGG + Intronic
1160730092 19:637975-637997 CTAAAATCACTGAACTGGCTGGG + Intergenic
1161005097 19:1931499-1931521 TTAATAAAAAAGAAGAGGCTGGG - Intergenic
1161213842 19:3083070-3083092 CTAAAAATACAAAAGTGGCTGGG - Intergenic
1161214271 19:3085559-3085581 CTAAAAACACAAAATTAGCTGGG - Intergenic
1161214695 19:3088248-3088270 CTAAAAACACAAAATTAGCTGGG + Intergenic
1161368656 19:3896426-3896448 CTAAAAACACAAAATTAGCTGGG - Intronic
1161416133 19:4147714-4147736 CTAAAAACACAAAATTAGCTGGG + Intergenic
1161489030 19:4551666-4551688 CTAAAAATACAAAATAAGCTGGG + Intronic
1161641844 19:5428754-5428776 CTCAAAAAAGAAAAGAGGCTGGG + Intergenic
1161810639 19:6469190-6469212 CTAAAAATACAGAATTAGCTGGG - Intronic
1162057014 19:8070859-8070881 CTAAAAATACAGAATTAGCTGGG + Intronic
1162082928 19:8229705-8229727 CTCAAAAAACAAAAAAGGCTGGG - Intronic
1162187798 19:8919709-8919731 CAAAAAACAAAAAACAGGCTGGG - Intronic
1162353222 19:10164302-10164324 CTAAAAATACAGAATTAGCTGGG - Intronic
1162400591 19:10444217-10444239 CTAAAAATACAAAATGGGCTGGG + Intronic
1162424324 19:10584934-10584956 AAAAAAACAAAGAAGAGGCCAGG + Intronic
1162436902 19:10666238-10666260 TTAAAAAGAAAAAAGAGGCTGGG - Intronic
1162523749 19:11196217-11196239 CTAAAAATACAGAATTAGCTAGG - Intronic
1162601090 19:11669780-11669802 CTAAAAACACAAAATTAGCTGGG - Intergenic
1162603571 19:11689425-11689447 CTAAAAATACAGAATTAGCTGGG + Intergenic
1162652914 19:12104503-12104525 CTAAAAACACAGAATTAGCCAGG - Intronic
1162748089 19:12810689-12810711 CTAAAAACACAAAATTAGCTGGG - Intronic
1162748108 19:12810823-12810845 ATAAAAACAAAAAATAGGCTGGG - Intronic
1162882839 19:13672981-13673003 CTAAAAATACAGAATTAGCTGGG - Intergenic
1163017354 19:14464488-14464510 CTCAAAAAACAAAACAGGCTGGG + Intronic
1163076528 19:14897401-14897423 CTAAAAATACAAAATTGGCTGGG - Intergenic
1163100097 19:15090359-15090381 CTAAAAACACAAAATTAGCTGGG - Intergenic
1163102304 19:15105681-15105703 CTAAAAACACAAAATTAGCTGGG - Intergenic
1163108151 19:15139796-15139818 TTAAAAACACAAAATAGGCCAGG + Intergenic
1163114855 19:15182801-15182823 CTAAAAACACAAAATTAGCTGGG - Intronic
1163360888 19:16845622-16845644 CTACACAGACAGAAGAGGCTAGG - Intronic
1163464881 19:17461685-17461707 CTAAAAATAAAAAATAGGCTGGG + Intergenic
1163524147 19:17810193-17810215 CTGAAAACACAAAAGTGGCTAGG + Intronic
1163588800 19:18178834-18178856 CTAAAAACACAAAATTAGCTGGG - Intergenic
1163659982 19:18571147-18571169 CTAAAAATACAAAAGTGGCCAGG + Intergenic
1163727420 19:18930711-18930733 CTAAAAACACAAAAAATGCCCGG + Intronic
1163735885 19:18980414-18980436 CTAAAAATACAGAAATGGCCAGG - Intergenic
1163736169 19:18982294-18982316 CTAAAAACACAAAATTAGCTGGG + Intergenic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1163792328 19:19314871-19314893 CTAAAAATACAAAATTGGCTGGG + Intronic
1163914113 19:20224267-20224289 CTAAAAATACAAAATTGGCTGGG + Intergenic
1163948249 19:20560617-20560639 CTAAAAATACAGAATTAGCTGGG + Intronic
1163997726 19:21067761-21067783 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1164001376 19:21103256-21103278 GTAAAAACACATAACAGGCCTGG + Intronic
1164208776 19:23079316-23079338 CTAAAAATACAAAATAAGCTGGG - Intronic
1164213811 19:23125193-23125215 ATAAAAACACACCAGAGACTGGG - Intronic
1164252604 19:23494842-23494864 ATAAATACACAAAAGAGGTTGGG + Intergenic
1164287301 19:23829594-23829616 ATAAATACACAAAAGAGGTTGGG - Intergenic
1164309176 19:24031249-24031271 CTAAAAATACAAAATTGGCTGGG - Intergenic
1164472283 19:28546334-28546356 ACAAAAACAGAGAAGCGGCTTGG + Intergenic
1165013175 19:32863420-32863442 CTCAAAAAATAAAAGAGGCTAGG - Intronic
1165233591 19:34403255-34403277 CTAAAAATACAAAAAAGGCCGGG + Intronic
1165462395 19:35951807-35951829 CTAAAAACACAAAATTAGCTGGG + Intergenic
1165527467 19:36368305-36368327 CTAAAAATACAGAATTAGCTGGG + Intronic
1165566556 19:36734328-36734350 CTAAAAAAACAGAAAAGGCCAGG + Intronic
1165621888 19:37255028-37255050 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1165646523 19:37443183-37443205 CTAAAAACACAAAATTAGCTGGG + Intronic
1165754429 19:38284134-38284156 CTAAAAAAAAAGCAGGGGCTGGG - Intronic
1165809288 19:38601108-38601130 CTAAAAATACAAAAGAAGCTAGG - Intronic
1166283767 19:41811147-41811169 GTTAAAACAGAGAAGAGGCCTGG - Intronic
1166527622 19:43522640-43522662 CTAAAAATACAAAATAAGCTGGG - Intronic
1166770980 19:45282060-45282082 CTAAAAACACAAAATTAGCTGGG + Intronic
1166776698 19:45317446-45317468 CTAAAAATACAGAATTAGCTGGG - Intronic
1166823481 19:45595113-45595135 CTAAAAATACAAAATAAGCTAGG + Intronic
1166880083 19:45923685-45923707 CTAAAAACACAAAATTGGCTGGG + Intergenic
1166954314 19:46452835-46452857 CTAAAAATACAAAAAAGGCGCGG + Intergenic
1166973974 19:46592599-46592621 CTAAAAACACAGAAAATAGTCGG + Intronic
1167024574 19:46905845-46905867 CTAAAAACACAAAATTAGCTGGG - Intergenic
1167069685 19:47213635-47213657 CTAAAAAAACAAAACAGGCTGGG - Intergenic
1167164805 19:47791198-47791220 CTAAAAACACAAAAATGGCATGG + Intergenic
1167165102 19:47793825-47793847 CTAAAAATACAAAAAAAGCTGGG - Intergenic
1167181612 19:47908160-47908182 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167182263 19:47913534-47913556 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167182928 19:47918911-47918933 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167183598 19:47924261-47924283 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167184228 19:47929301-47929323 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167184896 19:47934663-47934685 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167185552 19:47940026-47940048 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167186218 19:47945404-47945426 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167186868 19:47950777-47950799 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167187521 19:47956165-47956187 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167193478 19:48008838-48008860 CAAAAATCTCAGAAGAAGCTGGG + Intronic
1167253169 19:48412029-48412051 CTTAAAAAAAAAAAGAGGCTGGG + Intronic
1167254858 19:48421265-48421287 CTAAAAATACAAAACTGGCTGGG + Intronic
1167270935 19:48505698-48505720 CTAAAAATACAAAATAAGCTGGG + Intronic
1167316311 19:48765175-48765197 CTAAAAATACAAAAGTAGCTTGG + Intergenic
1167387935 19:49175368-49175390 CTAAAAATACAAAAAAGGCTGGG - Intronic
1167460990 19:49624694-49624716 CTCAAAGGACAGAGGAGGCTGGG - Intronic
1167541654 19:50092105-50092127 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167542327 19:50097442-50097464 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167542764 19:50100507-50100529 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167543634 19:50106628-50106650 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167544308 19:50111982-50112004 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167544983 19:50117335-50117357 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167545659 19:50122686-50122708 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167546336 19:50128014-50128036 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167547010 19:50133361-50133383 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167547668 19:50138733-50138755 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167614038 19:50521719-50521741 CTAAAAATACAAAATTGGCTGGG - Intronic
1167614332 19:50523661-50523683 TTAAAAACAAAAAAGAGGCCGGG + Intronic
1167747618 19:51361682-51361704 AAAAAAACCCAGGAGAGGCTGGG - Intronic
1167763775 19:51465709-51465731 CTAAAAATACAGAATTAGCTGGG + Intergenic
1167880733 19:52455358-52455380 CTAAAAACACAAAAGTAGCTGGG - Intronic
1167884351 19:52488110-52488132 CTAAAAACACAAAATTAGCTGGG - Intronic
1168054322 19:53853381-53853403 CTAAAAATACAGAATTAGCTGGG - Intergenic
1168108016 19:54176016-54176038 CTAAAAATACAAAAATGGCTGGG - Intronic
1168289372 19:55349964-55349986 CTAAAAATACAAAATAAGCTGGG + Exonic
1168333588 19:55584284-55584306 CTAAAAATACAAAATAAGCTGGG - Intergenic
1168395397 19:56043258-56043280 ATAAAAAAACAGTAGATGCTGGG - Intronic
1168403781 19:56100447-56100469 CTAATTCCGCAGAAGAGGCTGGG + Intronic
1168532779 19:57143030-57143052 CTAAAAATACAAAATTGGCTGGG + Intronic
1168594697 19:57665754-57665776 CTAAAAATACAAAATAAGCTGGG + Intergenic
1168656705 19:58134638-58134660 CTCAAAACACAGAGCAGGCCGGG + Intronic
1168656987 19:58137256-58137278 TAAAAATCACAGCAGAGGCTGGG + Intronic
1202653286 1_KI270707v1_random:25807-25829 CTAAAAACACAAAATTAGCTGGG + Intergenic
1202658862 1_KI270708v1_random:49936-49958 CTAAAAACACAAAATTAGCTGGG - Intergenic
925967538 2:9079876-9079898 CTAAATACAGAGCAGAGGCCAGG + Intergenic
926032601 2:9605430-9605452 TTAGAAACAGAGCAGAGGCTGGG - Intronic
926183151 2:10664133-10664155 CCAAAAAAACAGAACAGGCCGGG + Intronic
926183865 2:10672164-10672186 CTAAAAACACAAAATTAGCTGGG + Intronic
926374804 2:12215902-12215924 CTAAAAATACAGAATCAGCTGGG - Intergenic
926503917 2:13687129-13687151 CTAAAAACACAAAATAAGCTGGG + Intergenic
926607899 2:14915721-14915743 CTAAAAATACAAAATAAGCTGGG - Intergenic
926723088 2:15977238-15977260 CTAAAAACACAAAATTAGCTGGG - Intergenic
926731780 2:16041109-16041131 GTAAAAACGCAGAAGAGGCTGGG + Intergenic
926781610 2:16477837-16477859 CTTAAAGCACAGAAGTGGATGGG + Intergenic
926782291 2:16484461-16484483 CTATAAACACATCTGAGGCTGGG - Intergenic
926898120 2:17717684-17717706 TTAAAAAAATAGAAGAGGCTGGG + Intronic
927303483 2:21542803-21542825 CAAAAAGTATAGAAGAGGCTGGG + Intergenic
927396497 2:22656920-22656942 CTAAAAACACAAAAGTAGCTGGG + Intergenic
927418901 2:22908797-22908819 CTAAAAATACAAAAGTAGCTGGG - Intergenic
927628356 2:24747943-24747965 CTAAAAATACAAAAGTAGCTGGG + Intronic
927775882 2:25902808-25902830 CTAAAAACACAGAATTAGCTGGG - Intergenic
928289032 2:30021222-30021244 CTAAAAATACAAAAAAAGCTGGG - Intergenic
928298369 2:30105044-30105066 CTAAAAACACAAAATCAGCTGGG - Intergenic
928548170 2:32347637-32347659 CTAAAAACACAAAATTAGCTGGG - Intergenic
928550645 2:32367299-32367321 CTAAAAATACAAAATTGGCTGGG + Intronic
928933645 2:36651072-36651094 CAAAAAACTGGGAAGAGGCTGGG + Intergenic
929089072 2:38197020-38197042 CTAAAAACACAAAATTAGCTGGG - Intergenic
929134430 2:38609535-38609557 CTAAAAATACAAAAGTAGCTGGG + Intergenic
929597022 2:43182440-43182462 CTAAAAACACAAAATTAGCTGGG + Intergenic
929622072 2:43365218-43365240 TTAAAAACACAGATGAGGCCAGG - Intronic
929633515 2:43492015-43492037 TTTAAGATACAGAAGAGGCTGGG + Intronic
929695773 2:44114003-44114025 CTAAAAACACAAAATTAGCTGGG - Intergenic
930076662 2:47411265-47411287 CTAAAAACACAAAATTGGCCAGG - Intronic
930216044 2:48698633-48698655 CTAAAAGCACAGCAGTGGCTGGG + Exonic
930389750 2:50745993-50746015 ATCTGAACACAGAAGAGGCTGGG - Intronic
930649220 2:53947718-53947740 ACAAAAACACTGAAGAGGCCAGG + Intronic
930696133 2:54413664-54413686 CTAATAAGACATAAGAGGCCTGG + Intergenic
930749929 2:54924856-54924878 TGAAAAAAAAAGAAGAGGCTGGG - Intronic
930822742 2:55663681-55663703 CAAAAAACACTGAAACGGCTGGG + Intronic
930836097 2:55794921-55794943 CTAAAAATACAAAATTGGCTGGG - Intergenic
931251031 2:60530701-60530723 AAAAAAACACTGAAAAGGCTTGG + Intronic
931394588 2:61874979-61875001 CTAAAAACACAAAATTAGCTGGG + Intronic
931409168 2:62012477-62012499 CTAAAAACACAAAATTAGCTGGG - Intronic
931432493 2:62219434-62219456 CTAAAAATACAAAAAAGGCATGG - Intronic
931488929 2:62723806-62723828 CTTAAAAGCCAGAAGAGACTGGG - Intronic
931537125 2:63291511-63291533 TGAAAAACAAAGAGGAGGCTGGG + Intronic
931551964 2:63456477-63456499 CCAAAAACACAGCACAGGCTTGG - Intronic
931563892 2:63593253-63593275 CTAAAAATACAGAATTAGCTGGG - Intronic
931613969 2:64136608-64136630 TTAAAAATACAAATGAGGCTGGG + Intronic
931741438 2:65248850-65248872 CTAAAAACACAAAATTAGCTGGG + Intronic
931772742 2:65512679-65512701 CTAAAAACACCGAAAAGGTCCGG - Intergenic
932088342 2:68782273-68782295 CCACAAACCCAGAAGAAGCTGGG + Exonic
932447416 2:71789376-71789398 CTAAAAATACAAAATTGGCTGGG - Intergenic
932523075 2:72434085-72434107 CTAAAAACACTCAATAAGCTAGG - Intronic
932531370 2:72537306-72537328 TTAAAAACACAAAACAGGCCAGG + Intronic
932794249 2:74681022-74681044 GTAAAAACAAAGAAAAGGATGGG - Exonic
932893871 2:75619769-75619791 CTAAAAATACAAAAGTAGCTGGG - Intergenic
932974693 2:76585021-76585043 CTAAAAACACAAAATCAGCTGGG - Intergenic
933285707 2:80382545-80382567 ATAGGCACACAGAAGAGGCTGGG + Intronic
934497873 2:94825406-94825428 CTAAAAACACAAAATTAGCTGGG - Intergenic
934512789 2:94960719-94960741 AGAAAAACACACAGGAGGCTGGG - Intergenic
934665998 2:96171234-96171256 CTAAAAACACAAAAATGGCCGGG + Intergenic
935105354 2:100038518-100038540 TTATAAACACAGGAGAGGGTGGG + Intronic
935819430 2:106879193-106879215 ATACATACACAGAAGAGGCAGGG - Intronic
935934386 2:108166103-108166125 ATATAAACCAAGAAGAGGCTAGG - Intergenic
935936800 2:108194457-108194479 CTAGTAAAACAGAAGAGGCAGGG + Intergenic
936166278 2:110122470-110122492 CTAAAAACACAAAATTAGCTGGG - Exonic
936601562 2:113901155-113901177 CTAAAAACACAAAATTAGCTGGG + Intronic
936656476 2:114493882-114493904 CTAAAAATTCAGTAGAGGCCAGG - Intronic
936717170 2:115201165-115201187 TTAAAAACACAGAACCGGCCGGG + Intronic
936742428 2:115529328-115529350 CTAAAAACACAAAACTAGCTGGG - Intronic
936756177 2:115715176-115715198 CTAAAAACACAAAATTAGCTGGG + Intronic
936759538 2:115759713-115759735 ATAAAAACACATTATAGGCTGGG + Intronic
936771943 2:115924246-115924268 CTAAAAACACAAAATTCGCTGGG - Intergenic
937017158 2:118616684-118616706 CTAAAATAACAGGAGATGCTGGG + Intergenic
937041844 2:118828177-118828199 CCAAAAATACAGAAAAAGCTGGG + Intergenic
937642641 2:124230825-124230847 TTTAAAACACATTAGAGGCTGGG - Intronic
937956464 2:127424358-127424380 CTAAAAACACAAAATTAGCTGGG - Intronic
937999955 2:127725439-127725461 TTAAAAAAGCAGCAGAGGCTGGG + Intronic
938419108 2:131129663-131129685 CTAAAAACACAAAATTAGCTGGG - Intronic
938798773 2:134740834-134740856 CCAAAAACCCAGATGAGGCCAGG + Intergenic
938917672 2:135959228-135959250 CTAAAAATACAAAAGTAGCTGGG + Intronic
939560867 2:143730013-143730035 TTAGAAAAACAGAAGAGGCAAGG + Intronic
939649845 2:144746653-144746675 CTAAAAAATAAGAAGGGGCTGGG - Intergenic
939766753 2:146260203-146260225 CTAAATATAAAGAAGAAGCTGGG - Intergenic
940077578 2:149760298-149760320 CTAAAAATACAGAATTGGCCGGG - Intergenic
940582345 2:155598708-155598730 CTAAAAATACAAAATTGGCTGGG + Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940711668 2:157169810-157169832 ATAAAAACAACTAAGAGGCTGGG - Intergenic
940957669 2:159746560-159746582 CTAAAAACACAAAATTAGCTGGG - Intronic
940975528 2:159939210-159939232 TTAAAAATACAGATGAGGCCAGG + Exonic
941486387 2:166087303-166087325 CTAAAAACACAAAATTAGCTGGG + Intronic
941878813 2:170461311-170461333 CTAAAAACACAAAATTAGCTGGG + Intronic
941963472 2:171276612-171276634 CAAAAAACTGAGAAGAGGCTGGG - Intergenic
942294426 2:174504175-174504197 CTAAAAACACAAAAATAGCTGGG - Intergenic
942637269 2:178021120-178021142 CTAAAAACACAAAATTAGCTTGG - Intronic
943024782 2:182614716-182614738 CTAAAAATACAAAATTGGCTGGG - Intergenic
943091078 2:183375612-183375634 CTAAAAATACAAAATTGGCTGGG + Intergenic
943328389 2:186528734-186528756 CTAAAAACACAAAATTAGCTGGG + Intergenic
943448937 2:188024060-188024082 CTAAAAACAAAAAACAGGCTGGG - Intergenic
943726217 2:191254503-191254525 CTAAAAAAAAAAAAGAGGCCGGG - Intronic
943808216 2:192150784-192150806 TCAAAGACAAAGAAGAGGCTGGG - Intronic
943980438 2:194542766-194542788 CTAAAAACACTCAATAAGCTAGG + Intergenic
944079724 2:195773074-195773096 TTAAAATCACAGTAGAGGCCGGG - Intronic
944480631 2:200154065-200154087 CTGAGAACACAGAAAAGCCTGGG + Intergenic
944552065 2:200853543-200853565 ATAAAAACAGAAAAGAGGCCAGG + Intronic
944718946 2:202403842-202403864 CTAAAAATACAAAAGTAGCTGGG + Intronic
944723406 2:202446236-202446258 CTAAAAACACAAAATTAGCTGGG + Intronic
944805595 2:203277807-203277829 CTAAAAACCTAAAAGAGGCTGGG - Intronic
944846976 2:203678901-203678923 ATAAAAAGACAGCAGAGGCCAGG + Intergenic
945023533 2:205597795-205597817 CTTAAAAACCAGAAGAGACTGGG + Intronic
945235289 2:207626747-207626769 CTAAAAACACAAAAAAAGCCGGG - Intergenic
945259982 2:207834423-207834445 AAAAAAAAAAAGAAGAGGCTGGG - Intronic
945334718 2:208578956-208578978 CTAAAAACACAAAATTAGCTGGG + Intronic
945492345 2:210471338-210471360 GAAAAATCAAAGAAGAGGCTGGG - Intronic
946049170 2:216847394-216847416 TTAAAAATACAAACGAGGCTGGG - Intergenic
946223920 2:218252060-218252082 CTAAAAATACAGAATTAGCTAGG + Intronic
946232488 2:218300704-218300726 CTAAAAATACAAAATTGGCTGGG - Intronic
946273607 2:218614312-218614334 CTAAAAAAATACAAAAGGCTGGG - Intronic
946554803 2:220844023-220844045 GTAAAGGTACAGAAGAGGCTGGG - Intergenic
946661642 2:222007306-222007328 TTAAAAACAGGGAAGTGGCTGGG + Intergenic
946897570 2:224339881-224339903 CTAAAAACACAAAATTAGCTGGG + Intergenic
947167302 2:227275474-227275496 TAGAAATCACAGAAGAGGCTGGG - Intronic
947208491 2:227684092-227684114 CTAAAAAGACAAATGAGGCCTGG - Intergenic
947386737 2:229598267-229598289 GTAAAAGTACAGAAGAGGCAGGG - Intronic
947599979 2:231441146-231441168 CTAAAAATACAAAATAGGCCGGG - Intergenic
947620777 2:231589546-231589568 CTAAAAACAAAAACCAGGCTAGG + Intergenic
947711296 2:232317730-232317752 ATTAAAAAATAGAAGAGGCTAGG - Intronic
947814992 2:233030765-233030787 CTAAAAATACAAAAGTAGCTGGG + Intergenic
948418087 2:237831576-237831598 ATAAAAACATAGGATAGGCTGGG - Intronic
948624068 2:239256944-239256966 CTAAGAAGACAGAAGAACCTGGG + Intronic
948985723 2:241521774-241521796 TTAGAATCACAGAAGAGGCTAGG - Intergenic
949013514 2:241696094-241696116 CTCAAAAAACAAAACAGGCTGGG + Intergenic
1168776547 20:452852-452874 CTAAAAACAAAAACAAGGCTGGG + Intronic
1168904735 20:1393872-1393894 CGAAAAACAAAGAGAAGGCTGGG - Intergenic
1169148658 20:3271780-3271802 CTAAAAATACAAAATAAGCTGGG - Intronic
1169163148 20:3399776-3399798 ACACAAACACAGAAGAGGCCTGG + Intronic
1169298073 20:4417062-4417084 CTAAAAACACAAAAGTAGCTGGG + Intergenic
1169365746 20:4990819-4990841 CTAAAAACACAAAAGTGGCCAGG + Intronic
1169373481 20:5046624-5046646 CTAAAAATACAGAATTAGCTGGG + Intergenic
1169441263 20:5635828-5635850 CTAAAAATACAGAATTAGCTGGG + Intergenic
1169792489 20:9426536-9426558 CTAAAAACACAAAATTAGCTGGG - Intronic
1169887065 20:10411277-10411299 CTAAAAAAACAGAAAGGGCTGGG - Intronic
1170035432 20:11984597-11984619 CAAAAAACACAGTGGAGGCTGGG - Intergenic
1170097109 20:12657823-12657845 ATAAAAACATATCAGAGGCTGGG - Intergenic
1170230091 20:14036822-14036844 CAAAAAACACAAAAGTGGCTAGG - Intronic
1170312386 20:15007067-15007089 ATAAAAACCCAGGAGAGGCCGGG + Intronic
1170353105 20:15463947-15463969 CTAAAATCATAGAAGGGACTAGG - Intronic
1170638230 20:18128191-18128213 CTAAAAACACAAAATTAGCTGGG + Intergenic
1171033322 20:21695917-21695939 CTAAAAACACAAAATTAGCTGGG + Intergenic
1171545185 20:25995002-25995024 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1171946927 20:31387100-31387122 CTGAAAATACACAATAGGCTGGG - Intronic
1171998218 20:31750096-31750118 CTAAAAACACAAAATTAGCTGGG - Intronic
1172086910 20:32392441-32392463 CTAAAAATACAGAATTAGCTGGG - Intronic
1172251476 20:33482469-33482491 CTAAAAACACAAAATTAGCTAGG + Intergenic
1172335846 20:34114666-34114688 CTAAAAACACAAAATTAGCTGGG - Intergenic
1172343572 20:34178930-34178952 ATAAAATAACAGAAGCGGCTGGG + Intergenic
1172365654 20:34347070-34347092 CTAAAAATACAAAAGTTGCTGGG + Intergenic
1172418546 20:34793076-34793098 CTAAAATCTCAAAAAAGGCTGGG - Intronic
1172421564 20:34823220-34823242 AGAAAAACCCAGAATAGGCTGGG + Intronic
1172540108 20:35706175-35706197 CTAAAAACACAAAAGTAGTTGGG + Intronic
1172549571 20:35788529-35788551 ATAAAAACAGAAAAGAGGCCAGG - Intronic
1172926561 20:38542294-38542316 CTGAACTCACAGAAGATGCTGGG - Intronic
1172981214 20:38943317-38943339 TTAAAAGCACAGAGCAGGCTGGG - Intronic
1173069130 20:39744528-39744550 GGAAAAGCACAGTAGAGGCTGGG - Intergenic
1173080982 20:39867290-39867312 AAGAAATCACAGAAGAGGCTGGG + Intergenic
1173970288 20:47147349-47147371 CTCAAAAGTCAGAAGAGCCTGGG - Intronic
1174198780 20:48792307-48792329 CTAAAAACACAAAATTAGCTGGG + Intronic
1174256425 20:49258940-49258962 CTAAAAATACAAAATAAGCTGGG + Intronic
1174520349 20:51124970-51124992 CTAAAAATACAAAATTGGCTGGG + Intergenic
1174566723 20:51470008-51470030 CTGACAACACCGAGGAGGCTGGG + Intronic
1174594825 20:51675582-51675604 CTAAAAGCACAAAAAATGCTGGG + Intronic
1174608575 20:51780093-51780115 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1174739004 20:52993996-52994018 AGAATAACACAAAAGAGGCTTGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175101020 20:56578881-56578903 CTAAAAACACAAAATTAGCTGGG + Intergenic
1175145772 20:56895157-56895179 CTTAAAACCTAGATGAGGCTGGG - Intergenic
1175386575 20:58599812-58599834 CTAAAAACACAGATTAGGGCCGG + Intergenic
1175432467 20:58915657-58915679 CTAAAAAGACAGAAGAAGGAAGG - Intergenic
1175532225 20:59681847-59681869 CTAAAAACACAAAATTAGCTGGG + Intronic
1175545754 20:59776659-59776681 ATTTAAACACAGAAGAGGATGGG + Intronic
1175953814 20:62597741-62597763 ATAGAAACACAGAAGAGGTGTGG + Intergenic
1175989984 20:62783850-62783872 CAAAAATCACAAAAGACGCTGGG + Intergenic
1176422991 21:6531364-6531386 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1176598872 21:8773848-8773870 CTAAAAACACAAAATTAGCTGGG - Intergenic
1176629198 21:9121217-9121239 CTAAAAACACAAAATTAGCTGGG + Intergenic
1176644799 21:9340123-9340145 CTAAAAACACAAAATTAGCTGGG - Intergenic
1176799223 21:13406988-13407010 CCAAAAACACAGAAGACATTGGG - Intergenic
1177005634 21:15669048-15669070 CTAAAAACACAAAATTAGCTGGG + Intergenic
1177052175 21:16250044-16250066 ATAAAAACAGGGCAGAGGCTGGG - Intergenic
1177184476 21:17778648-17778670 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1177212663 21:18089751-18089773 CTTACAACAAAGAAGAGGATAGG + Intronic
1177793714 21:25749668-25749690 CTAAAAATACAGAATAAGCTGGG + Intronic
1177805788 21:25873358-25873380 CTAAAAACACAAAAAATACTCGG - Intergenic
1177846920 21:26300254-26300276 ATAAAAACATAAAACAGGCTGGG - Intergenic
1177931331 21:27287730-27287752 CTAAAAACAAAGAAGAAGGGAGG + Intergenic
1178246760 21:30960527-30960549 CTAAAAACACAAAATTAGCTGGG + Intergenic
1178285424 21:31321644-31321666 TTTAAAACACAGAAGAGGCTGGG - Intronic
1178668310 21:34567981-34568003 CTAAGCGCACAGAAGGGGCTCGG + Intronic
1178772345 21:35517499-35517521 CTAAAAATACAAAACTGGCTGGG - Intronic
1178793783 21:35724245-35724267 ATTAAAACTCAGAGGAGGCTGGG - Intronic
1179220788 21:39405126-39405148 CTAAAAAAAAAAAATAGGCTGGG - Intronic
1179306483 21:40157987-40158009 CCAAAAATAGATAAGAGGCTAGG - Intronic
1179641795 21:42752558-42752580 CAAAAATCTCAGATGAGGCTGGG - Intronic
1179698485 21:43139681-43139703 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1179875582 21:44265748-44265770 CTAAAAATACAAAAAATGCTGGG - Intergenic
1180368151 22:11959110-11959132 CTAAAAACACAAAATTAGCTGGG + Intergenic
1180377940 22:12112221-12112243 CTAAAAACACAAAATTAGCTGGG - Intergenic
1180419571 22:12801058-12801080 CTAAAAACACAAAATTAGCTGGG + Intergenic
1180704250 22:17799219-17799241 CTAAAAACACAAAATTAGCTGGG + Intronic
1181387258 22:22555531-22555553 CTAAAAAAGAAAAAGAGGCTGGG - Intronic
1181410873 22:22718202-22718224 CCAAAAACACACAAGATGGTTGG + Intergenic
1181645193 22:24227243-24227265 CAAAAAACACAAAAAAGGCGGGG - Intronic
1181753236 22:25004649-25004671 CTAAAAGTGTAGAAGAGGCTGGG + Intronic
1181851878 22:25755175-25755197 TTAAAAAGACACAAGAAGCTGGG - Intronic
1181944567 22:26506007-26506029 CTAAAAACAAAAATGAGGCTGGG - Intronic
1182605576 22:31500616-31500638 CTAAAAACACAAAATTAGCTGGG - Intronic
1182633155 22:31703109-31703131 CTTAAAACACAGCAGGGGCCAGG - Intronic
1182633242 22:31703956-31703978 CTAAAAATACAGAATTAGCTGGG - Intronic
1182740800 22:32566005-32566027 CTAAAAAAATAAAATAGGCTGGG - Intronic
1182808380 22:33095012-33095034 ATAAGAACACAGGAGAGGCCAGG - Intergenic
1182864657 22:33593132-33593154 TTAAAAACAGAAAAAAGGCTGGG - Intronic
1182906057 22:33937322-33937344 ATAAAAACACAAAACAGGCCGGG - Intergenic
1183440710 22:37821686-37821708 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
1183452115 22:37902331-37902353 CAAAAAACAAAAAACAGGCTGGG - Intergenic
1183779985 22:39993345-39993367 AGACAAACACAGAAGAGGATAGG - Intergenic
1183866803 22:40710701-40710723 CAAATAAAACAGAGGAGGCTGGG - Intergenic
1183893460 22:40949877-40949899 CTAAAGAGAAAGAATAGGCTGGG - Intergenic
1184003561 22:41692714-41692736 AAAAAAAAAAAGAAGAGGCTGGG - Intronic
1184214682 22:43058986-43059008 CAAAAAACAAAAAACAGGCTGGG - Intronic
1184404108 22:44290366-44290388 CTAAAAACACAAAATTAGCTGGG + Intronic
1184436599 22:44482388-44482410 TTAAAAACAATTAAGAGGCTGGG - Intergenic
1184456227 22:44611176-44611198 CTAAAAACACAAAATTAGCTGGG + Intergenic
1184539312 22:45109614-45109636 CTAAAAATACAGAATTAGCTGGG - Intergenic
1184811799 22:46840439-46840461 CCAAAAAAACAAATGAGGCTGGG + Intronic
1184826497 22:46956183-46956205 CTAATACCACAGAAGATGTTTGG + Intronic
1184979580 22:48086413-48086435 CAAAAAAAACAGAAGATACTAGG - Intergenic
1185290662 22:50025369-50025391 ATAAATACACAGAAGAGGCCGGG + Intronic
1185381514 22:50510214-50510236 TTAAAAACAAAAAAGAGGCCGGG - Intronic
1185408069 22:50667332-50667354 TTAAAAACAAAGAAGAGGCTTGG + Intergenic
949233628 3:1781933-1781955 CTAAAAACACAAAAATAGCTGGG - Intergenic
949272415 3:2234215-2234237 CTAAAAACACAAAATTAGCTGGG + Intronic
949707929 3:6840368-6840390 CTAAAAACACAAAATTAGCTGGG - Intronic
949735713 3:7169474-7169496 CTAAAAACACAGAAGGGATGTGG + Intronic
950061594 3:10076539-10076561 CTAAAAAGAAAAAAGAGGCAAGG - Intronic
950064776 3:10103239-10103261 CTAAAAACACAAAATTAGCTGGG + Intronic
950346312 3:12296788-12296810 ATAAAATCACAGAAGATGATCGG + Intronic
950565208 3:13765495-13765517 CTAAAAATACAAAAGTAGCTGGG + Intergenic
950738068 3:15027158-15027180 CTAAAAACACAAAATTGGCCAGG - Intronic
950884622 3:16352596-16352618 CTAAAAGCACAGAGGAGGTTGGG - Intronic
950963668 3:17131082-17131104 TCAAAAACACAGAAGAGCCAAGG + Intergenic
951505436 3:23439974-23439996 TTAAAAAAAAAAAAGAGGCTGGG + Intronic
951927606 3:27925501-27925523 CTAAAAATACAAAAGTAGCTGGG - Intergenic
952374815 3:32757338-32757360 CTAAAAATACAAAATTGGCTGGG - Intronic
952577547 3:34793531-34793553 AGTAAGACACAGAAGAGGCTGGG - Intergenic
952783882 3:37132926-37132948 CTAAATTCACAGTAAAGGCTGGG + Intronic
952930131 3:38353604-38353626 CTAAAAACCCGGTTGAGGCTGGG - Intronic
953329609 3:42041951-42041973 CTAAAAATACAAAAGTAGCTGGG - Intronic
953353824 3:42237253-42237275 CTAAAAACCAAAAATAGGCTGGG + Intergenic
953360797 3:42294521-42294543 TTAAAAACACTAAAGGGGCTGGG - Intergenic
953635702 3:44662143-44662165 CTAAAAATACAAAAAAGGCTGGG - Intergenic
954033799 3:47839453-47839475 CTAAAAACACAAAATCAGCTGGG - Intronic
954169724 3:48791431-48791453 CTAAAAACACAAAATTAGCTGGG + Intronic
954182844 3:48895167-48895189 CTAAAAACACAAAATTAGCTGGG - Intronic
954186821 3:48923680-48923702 CTAAAAACACAAAATTAGCTGGG - Intronic
954348334 3:50020218-50020240 CTAATAACAAAAATGAGGCTGGG - Intronic
954737349 3:52717244-52717266 CTAAAAATACAAAATTGGCTGGG + Intronic
954741081 3:52751147-52751169 CTAAAAACACAAAAGTAGCCGGG + Intronic
955022584 3:55135297-55135319 CTAAAAACTGAGAATAGGCCTGG - Intergenic
955039582 3:55302779-55302801 TTAAAAACACAAGAGAGGCCAGG + Intergenic
955055163 3:55448136-55448158 CTAAAAGCCAGGAAGAGGCTGGG + Intergenic
955173733 3:56590761-56590783 ATAAAAACACAAAAGAGAATAGG + Intronic
955289042 3:57673928-57673950 CTAAAAATACAAAATTGGCTGGG - Intronic
955295638 3:57732615-57732637 CTAAAAATACAAAATTGGCTGGG + Intergenic
955304683 3:57818314-57818336 CTAAAAACACAAAATTAGCTGGG - Intronic
955585653 3:60474782-60474804 CTAAAAATACAAAAGTAGCTGGG - Intronic
955589382 3:60518191-60518213 TTAAAGAAACTGAAGAGGCTAGG + Intronic
956110505 3:65865799-65865821 CTAAAAATACAGAATTAGCTGGG - Intronic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
956772642 3:72539429-72539451 CTAAAGAGACAGAAATGGCTGGG - Intergenic
957095529 3:75773886-75773908 CTAAAAACACAAAATTAGCTGGG + Intronic
957439486 3:80225299-80225321 CTAAAAATACAGAAATAGCTGGG + Intergenic
957798164 3:85039160-85039182 CTAAAAACACAAAATAAGCTGGG - Intronic
958194205 3:90221446-90221468 CTAAAAACACAAAATTAGCTGGG + Intergenic
958778493 3:98513522-98513544 CTAAAAATACAAAAGTTGCTGGG + Intronic
958941068 3:100315321-100315343 CTAAAAATACAAAATTGGCTGGG - Intronic
958943827 3:100341878-100341900 CTAAAAATACAAAATTGGCTGGG + Intronic
958948615 3:100393013-100393035 CTAAAAACACAAAATTAGCTGGG + Intronic
959149832 3:102595330-102595352 ATAAAGACACAGCAGAGACTGGG + Intergenic
959495436 3:107045556-107045578 ATTAAAACTCAGAAGAGCCTGGG + Intergenic
959925191 3:111913238-111913260 ATAAAAAGACTGAAGAGGCTGGG - Intronic
960106928 3:113807967-113807989 CTAAAAATACAGAATTAGCTGGG + Intronic
960112520 3:113858695-113858717 CTAAAAATACAAAAGTAGCTGGG - Intronic
960534791 3:118803720-118803742 CTAAAAACACAAAATTAGCTAGG - Intergenic
960705859 3:120480333-120480355 CTAAAAATACAAAAGTAGCTGGG - Intergenic
960892373 3:122463054-122463076 CTAAAAATACAAAAAAGGCCGGG + Intronic
961157326 3:124691265-124691287 CTAAAAATACAGAATTAGCTGGG + Intronic
961602879 3:128074679-128074701 CTAAAAACACAAAATTAGCTGGG + Intronic
961762172 3:129179114-129179136 CTAAAAACACAAAATTGGCCGGG + Intronic
961797938 3:129423329-129423351 CTAAAAAATCAGAAGGGGCCAGG + Intronic
961985421 3:131127258-131127280 TTAAAAACATAGAAAAGGCTAGG - Intronic
962226565 3:133615899-133615921 TTAAAAACTAAAAAGAGGCTGGG - Intronic
962283525 3:134069136-134069158 CTAAAAACACAAAATTAGCTGGG + Intronic
962298131 3:134212630-134212652 CTAAAAACAAAGAAAAGCTTTGG - Intronic
962659798 3:137589825-137589847 ATAAAAACAGACAGGAGGCTGGG - Intergenic
962789062 3:138794256-138794278 TTAAAAACTCACAAGATGCTGGG - Intronic
963097079 3:141555098-141555120 CTAAAAATACAGAATTAGCTGGG + Intronic
963217260 3:142762329-142762351 AAAAAAATACAGAAGAGGCCAGG - Intronic
963232408 3:142921726-142921748 CTAAAAATACAAAAGGAGCTGGG - Intergenic
963255208 3:143138166-143138188 CTAAAAACACAAAATTAGCTGGG - Intergenic
963310705 3:143707162-143707184 CTAAGAAGACAGTAGAGGCCAGG - Intronic
963735943 3:149017906-149017928 CTAAAAACAAAATAGAGGCTGGG - Intronic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
963905741 3:150772292-150772314 CTTAAAACACATAATAGGCTGGG - Intergenic
964143820 3:153434275-153434297 CCAAAAACAAAAAAGAGGGTGGG + Intergenic
964221183 3:154347222-154347244 ATAAAGACACACACGAGGCTAGG + Intronic
964338754 3:155685862-155685884 TCACAAACACACAAGAGGCTTGG + Intronic
964375226 3:156042619-156042641 CAAAACAAACAGAAGAGGATGGG - Intronic
964683413 3:159367229-159367251 CTAAAAATACAAAATAAGCTGGG + Intronic
964750212 3:160047486-160047508 CTAAAAATACAGAATTAGCTGGG + Intergenic
964943479 3:162189973-162189995 CTAAAAACACACCTGAGACTGGG - Intergenic
965241524 3:166205564-166205586 CTAAAAACACAAAATTAGCTGGG + Intergenic
965242901 3:166226973-166226995 CTAAAAACACAAAATTAGCTGGG - Intergenic
965538422 3:169848749-169848771 ATAAAAACAGACAACAGGCTGGG - Intronic
965804404 3:172527207-172527229 ATAGAAACAAACAAGAGGCTGGG - Intergenic
965922130 3:173929863-173929885 CTAAAAACACAAAATTAGCTGGG - Intronic
966418697 3:179716083-179716105 CTAAAAATACAGAATTAGCTTGG - Intronic
966507923 3:180727687-180727709 ACAAAAACAAAAAAGAGGCTGGG - Intronic
966509433 3:180745323-180745345 TTAAAAACACACATTAGGCTGGG + Intronic
966746335 3:183280685-183280707 CTAAAAACACAAAATTAGCTGGG + Intronic
966792698 3:183688496-183688518 CTAAAAATACAAAACAAGCTGGG - Intergenic
966802638 3:183778515-183778537 CTAAAAACACAAAATTAGCTGGG - Intronic
966841716 3:184094736-184094758 CTAAAAATACAGAATTAGCTGGG + Intergenic
966890927 3:184407000-184407022 TTAAAAGCATAGAAGAGGCAGGG + Intronic
966926268 3:184646543-184646565 CTCAAAACACAGACCAGGCCGGG - Intronic
966974749 3:185073959-185073981 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
967071868 3:185969332-185969354 CTAAAAATACAAAATTGGCTGGG + Intergenic
967099788 3:186206908-186206930 CTAAAAACACAAAATTAGCTGGG - Intronic
967159730 3:186725004-186725026 CCCTAAACAAAGAAGAGGCTGGG - Intronic
967310203 3:188098864-188098886 CTAAAGAAACAGATGAGGCCGGG + Intergenic
967365410 3:188681155-188681177 CTAAAAATACAAAAGTAGCTGGG - Intronic
967794361 3:193583135-193583157 ATAAAAATAAAGAAGGGGCTGGG + Intronic
967920920 3:194613825-194613847 ATAAAAAAACAGAATAGGCCGGG + Intronic
968180750 3:196593376-196593398 TTAAAAACAAACAAAAGGCTGGG - Intergenic
968214256 3:196874716-196874738 CTAAAAATACAAAATTGGCTGGG + Intronic
968217822 3:196908660-196908682 CTAAAAATACAAAATTGGCTGGG + Intronic
968314840 3:197715126-197715148 CTAAAAACACAAAACTGGCTGGG + Intronic
968326611 3:197823261-197823283 CTAAAAATACAAAAAAGGCCGGG - Intronic
1202742092 3_GL000221v1_random:64945-64967 CTAAAAACACAAAATTAGCTGGG + Intergenic
968424256 4:511130-511152 CTAAAAATACAAAATTGGCTGGG + Intronic
968440123 4:619206-619228 CTAAAAACACAGAAATTGGTTGG - Intergenic
968772798 4:2518781-2518803 CTAAAAATACAAAAGTAGCTGGG + Intronic
969051894 4:4379062-4379084 TTAAAAAAAGAGAAGATGCTGGG - Intronic
969910313 4:10438631-10438653 CTAAAAACACAAAATTAGCTGGG + Intergenic
970393310 4:15639001-15639023 CTAAAAATACAGAAGTAGCCGGG + Intronic
970875067 4:20859689-20859711 CTTAAAATACAGTAGAAGCTTGG + Intronic
970897418 4:21119922-21119944 TTAGAAACACAGAAGAGGAAAGG + Intronic
970988657 4:22187944-22187966 CTAAAAATACAGAATTAGCTGGG + Intergenic
971303443 4:25460927-25460949 AAAAAAAAAAAGAAGAGGCTGGG + Intergenic
971337204 4:25734339-25734361 TTAAAAACACATAGCAGGCTGGG - Intergenic
971349610 4:25844197-25844219 CTAAGAACAAACCAGAGGCTTGG + Intronic
971380427 4:26092215-26092237 CAAAAAAATCAGATGAGGCTGGG - Intergenic
971503552 4:27342132-27342154 TTAAATATGCAGAAGAGGCTGGG - Intergenic
971565760 4:28138757-28138779 ATAAAATCATAGAAAAGGCTGGG - Intergenic
971638002 4:29088400-29088422 CTAAAAACACAGAAAATACCCGG + Intergenic
971779358 4:31011613-31011635 TGAAAATCACAGAAAAGGCTGGG + Intronic
971865833 4:32170616-32170638 CTAAAAACACAAAATTAGCTGGG - Intergenic
972066860 4:34957679-34957701 CTAAAAACACAAAATTAGCTGGG + Intergenic
972306778 4:37838174-37838196 TTAAAAACAGAGAAAAGGCCGGG - Intronic
972419960 4:38877801-38877823 CTAAAAACACAAAATAAGCCAGG + Intronic
972439674 4:39075168-39075190 CTAAAAATACAAAAGTAGCTGGG + Intronic
972468588 4:39382777-39382799 CTAAAAACACAAAATTAGCTGGG - Intergenic
972535080 4:39993213-39993235 CTAAAAATACAAACAAGGCTGGG - Intergenic
972637675 4:40898710-40898732 CTTAAAACACACAACAGGCCGGG + Intronic
973199791 4:47487066-47487088 CTAAAAATACAAAATTGGCTGGG + Intronic
973362211 4:49176215-49176237 CTAAAAACACAAAATTAGCTGGG - Intergenic
973398885 4:49620645-49620667 CTAAAAACACAAAATTAGCTGGG + Intergenic
973720405 4:53718194-53718216 CTAAGAAAAAAGAGGAGGCTGGG + Intronic
973893248 4:55388676-55388698 CAAAAAACAAAAAACAGGCTGGG + Intergenic
973964249 4:56144947-56144969 CTAAAAACACAAAATTAGCTGGG - Intergenic
973967653 4:56180326-56180348 CTAAAAACACAAAAACAGCTGGG + Intronic
973990273 4:56398743-56398765 CTAACTACACAAAATAGGCTGGG - Intronic
974120748 4:57635126-57635148 ATAAAAAGACAAAAGTGGCTAGG - Intergenic
974383042 4:61167076-61167098 CCAAAAGCAAAGAAGAGGCAAGG + Intergenic
974474656 4:62362953-62362975 CTAAAAATACAAAAGTAGCTGGG - Intergenic
974908374 4:68084475-68084497 CTTATAAGCCAGAAGAGGCTGGG + Intronic
975298014 4:72756413-72756435 TAAAAAACCCAGAAGAGGCCGGG + Intergenic
975343898 4:73272536-73272558 CTAAAAACACAAAATTAGCTAGG - Intergenic
975581712 4:75912611-75912633 CTAAAAATACAGAATAAGCTGGG + Intergenic
975821010 4:78270462-78270484 CAAAATACACAGAAGAGGGTAGG - Intronic
975935111 4:79570247-79570269 CTAAAAATACAGAATTAGCTGGG - Intergenic
975976033 4:80097788-80097810 ATAAAAACAAGGAAGAGGTTTGG - Intronic
976525176 4:86078826-86078848 CTAAAAATACAAAAGCAGCTGGG + Intronic
976527983 4:86115620-86115642 CTAAAAATACAAAATAAGCTGGG - Intronic
976564501 4:86538305-86538327 CTAAAAACACAAAATTAGCTAGG - Intronic
976615622 4:87072825-87072847 TTAAATAAACACAAGAGGCTGGG - Intronic
976647110 4:87398452-87398474 CTAAAAACACAAAATTAGCTGGG + Intergenic
977423728 4:96838034-96838056 GTAAAAACACACAACAGACTGGG - Intergenic
977668323 4:99666993-99667015 CCAAAGACACATAAAAGGCTGGG + Intergenic
978227744 4:106358369-106358391 CAGAAAAAATAGAAGAGGCTGGG - Intergenic
978499470 4:109393629-109393651 TTAAAAACACAGGAGGGGCCGGG - Intergenic
978608279 4:110506958-110506980 ATAAGAACACAGTACAGGCTGGG - Intronic
978717005 4:111856594-111856616 CTAAAGCCATGGAAGAGGCTGGG + Intergenic
978773938 4:112486753-112486775 CTAAAAATACAAAAAAAGCTGGG + Intergenic
979248034 4:118531755-118531777 TTTAAAAAACAAAAGAGGCTGGG - Intergenic
979375744 4:119944529-119944551 TTAAAAACACAGATGAGACTGGG - Intergenic
979382976 4:120030422-120030444 TTAAAAACACAGATAAGACTGGG + Intergenic
979529742 4:121757146-121757168 CTAAAAACACAAAATTAGCTGGG + Intergenic
979697946 4:123635447-123635469 CTAAAAACACTCAAGAAACTAGG - Intergenic
980020034 4:127697957-127697979 CTAAAAATACAAAATAAGCTGGG + Intronic
980122597 4:128743272-128743294 CTAAAAATACAAAATAAGCTGGG - Intergenic
980224920 4:129970161-129970183 CTAAAAAGAGAGTTGAGGCTGGG - Intergenic
980467660 4:133205742-133205764 ATAAAAACTCAGTAGAGGTTTGG - Intronic
980687784 4:136253247-136253269 ATAAAAACACAAAATAGGCCCGG + Intergenic
980777768 4:137458960-137458982 CTAAAAACACAAAATTAGCTGGG - Intergenic
980834425 4:138173471-138173493 CTAAAAATACAAAATAAGCTGGG + Intronic
981086320 4:140688368-140688390 TTAAAAACACAAAACTGGCTGGG + Intronic
981258359 4:142690443-142690465 ATAAAACCACTGAAGAGGGTGGG - Intronic
981642124 4:146956811-146956833 GAAACAACACAGAAGAGGCATGG - Intergenic
981770305 4:148300731-148300753 CTAAAAATACAAAAGTAGCTGGG - Intronic
981842395 4:149127731-149127753 AGAAACTCACAGAAGAGGCTGGG + Intergenic
981853548 4:149259625-149259647 CTAAAAACAGACAAGATGCTAGG - Intergenic
981855208 4:149281193-149281215 CTAAAATTACAGAACAAGCTCGG - Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982493877 4:156065511-156065533 CTAAAAATACAAAATTGGCTGGG + Intergenic
982854170 4:160360932-160360954 CTAAAAATACAGAATTAGCTGGG - Intergenic
982936042 4:161476485-161476507 TTAAAAAAACAGCAGTGGCTGGG - Intronic
983061838 4:163169399-163169421 CTAAAGACAGAGAAGATACTTGG + Intergenic
983212315 4:164971428-164971450 CTAAAAACACAGAATTAGCTGGG + Intronic
983249725 4:165329927-165329949 CTAAAATCACTAAGGAGGCTGGG - Intronic
983572664 4:169226869-169226891 TTAAAAATACATAAGAGGCCAGG + Intronic
984414682 4:179442756-179442778 TTAAAAATACAGCAGTGGCTGGG - Intergenic
984438495 4:179734813-179734835 CTAAAAACACAAAATTAGCTGGG - Intergenic
984574145 4:181427875-181427897 CTAAAAACACAAAATTAGCTGGG + Intergenic
984737393 4:183122678-183122700 CTAAAAACACAAAATTAGCTAGG - Intronic
984880309 4:184404945-184404967 GTAAAAACTCAGTAGAGGCCAGG + Intronic
985014211 4:185616371-185616393 CTAAAAACAAAGAAGATTCATGG + Intronic
985042506 4:185905757-185905779 ACAAAAAGACAGAAGAGGCCGGG - Intronic
985089201 4:186346198-186346220 CTAAAAACTAAATAGAGGCTGGG + Intergenic
985094744 4:186402372-186402394 CTAAAAACACAAAATTAGCTGGG - Intergenic
985125956 4:186694665-186694687 CTTAAAATACAAAACAGGCTGGG + Intronic
985164302 4:187076165-187076187 CTAAAAACACAAAATTGGCCGGG + Intergenic
1202759556 4_GL000008v2_random:97685-97707 CTAAAAACACAAAATTAGCTGGG - Intergenic
985699947 5:1364925-1364947 CTAAAAATACAAAAGTGGCCAGG + Intergenic
986013883 5:3740757-3740779 CTGAGGACACAGAAGAGGTTGGG - Intergenic
986235715 5:5908102-5908124 CTAAAAACACAAAATTAGCTGGG + Intergenic
986289101 5:6384515-6384537 TTAAAAATAAAAAAGAGGCTGGG + Intergenic
986725292 5:10591470-10591492 ATAAAAACACTAAAAAGGCTCGG - Intronic
986816518 5:11418243-11418265 CTAAAAATACAAAAGTAGCTGGG + Intronic
986884653 5:12218124-12218146 CTAAAAATACAGTTTAGGCTGGG + Intergenic
987052321 5:14157881-14157903 AGAAAAACACAGAACAGGCTGGG - Intronic
987229126 5:15874229-15874251 CTAAAAACACACAATAAACTAGG + Intronic
987290357 5:16502903-16502925 CCATAAAGAGAGAAGAGGCTGGG + Intronic
987609409 5:20182439-20182461 CTAAAAATACAAAATTGGCTGGG + Intronic
987705764 5:21460823-21460845 ATAAAAAAATAGAAAAGGCTGGG - Intergenic
987821189 5:22968944-22968966 CTTACAAAACAGAAGAGACTGGG - Intergenic
987848411 5:23317898-23317920 CTAAAAACACAAAATTAGCTGGG - Intergenic
987969780 5:24927790-24927812 CTAATAACAAAGAAGAGTCAAGG + Intergenic
988012856 5:25512815-25512837 CTAAAAACTCACAATAAGCTAGG - Intergenic
988042209 5:25904523-25904545 CAAAAAACAAAAAAGAGGCCAGG + Intergenic
988176989 5:27741805-27741827 ATAAAGACATACAAGAGGCTGGG + Intergenic
988292422 5:29305621-29305643 CTAAAAATACAGAATTAGCTAGG - Intergenic
988575220 5:32416451-32416473 CTAAAAATACAGAATTAGCTGGG + Intronic
988709817 5:33762211-33762233 ATAAAAAAATAAAAGAGGCTGGG + Intronic
988822523 5:34901599-34901621 CTAAAAATACAGAATTAGCTGGG + Intergenic
989005665 5:36809402-36809424 CTAAAAACACAAAATTAGCTGGG - Intergenic
989054510 5:37354305-37354327 CTAAAAATACAAAATAAGCTGGG - Intronic
989247304 5:39268724-39268746 CTAAAAACACAAAATTAGCTGGG - Intronic
989254208 5:39349189-39349211 AAAAAAACACAGAAAAGACTAGG + Intronic
989388484 5:40876530-40876552 CTAAAAATACAGAATTAGCTGGG + Intergenic
990296696 5:54408680-54408702 CTAAAAACACAAAATTAGCTGGG + Intergenic
990428323 5:55710995-55711017 TTAAAAAGAAAAAAGAGGCTGGG + Intronic
991061329 5:62379499-62379521 CTAAAAATACAGAATTAGCTGGG + Intronic
991405985 5:66301614-66301636 TTAAAAACACTGAGGGGGCTGGG + Intergenic
991697542 5:69287422-69287444 CTAAAAATACAAAATTGGCTGGG - Intronic
992236659 5:74716892-74716914 CTAAAAACTCAGATTGGGCTGGG + Intronic
992461173 5:76961721-76961743 AAAAAAACACAGAAGAGCATTGG - Intronic
992504154 5:77368905-77368927 CAAAAGAAAAAGAAGAGGCTGGG + Intronic
992504558 5:77374009-77374031 CTAAAAACACAAAATTAGCTGGG - Intronic
992622147 5:78604314-78604336 CTAAAAATACAAAATTGGCTGGG + Intronic
992795206 5:80249639-80249661 CTAAAAACACAAAATTAGCTGGG + Intronic
993188689 5:84653354-84653376 CTAAAAACACAAAATTAGCTGGG - Intergenic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
993702870 5:91138930-91138952 CTAAAAACACAAAATTAGCTGGG - Intronic
994199733 5:96959081-96959103 CTTAAAAGGCAGAAGAGGTTGGG - Intronic
994417009 5:99484820-99484842 ATAAAAACATACCAGAGGCTGGG - Intergenic
994462966 5:100090354-100090376 ATAAAAACATACCAGAGGCTGGG + Intergenic
994473252 5:100236944-100236966 CTACAAACCCAGAAGAGATTAGG - Intergenic
994559507 5:101349094-101349116 CTTAAAAGACAGAAGAGATTGGG + Intergenic
994658110 5:102619568-102619590 TTAAAATCACAGAAGAGGCTGGG + Intergenic
994932999 5:106213665-106213687 CTAAAAATACAAAATAAGCTGGG + Intergenic
995089344 5:108154427-108154449 CTAAAAACACAAAATTAGCTGGG + Intronic
995160194 5:108970513-108970535 CTAAAAATAAAGTATAGGCTGGG - Intronic
995167096 5:109056416-109056438 GTCAAAACACAGATGAGCCTGGG + Intronic
995353186 5:111205830-111205852 CCAAAAACTCAGAAGAGGATTGG - Intergenic
995904476 5:117107003-117107025 CTAAAAACACAAAATTAGCTGGG - Intergenic
995940214 5:117572585-117572607 AAAAACACACAGAAGAGGCCTGG - Intergenic
996406502 5:123110725-123110747 CTAAAAATACAGAATAAGCTGGG - Intronic
997146778 5:131443103-131443125 CTAAAAATACAGAATTAGCTGGG - Intronic
997492698 5:134291611-134291633 CTAAAAATACAAAAGTAGCTGGG + Intronic
997544470 5:134694362-134694384 CTAAAAATACAAAATTGGCTGGG + Intronic
997551486 5:134757325-134757347 CTAAAAATACAAAATAAGCTGGG + Intergenic
997605678 5:135174243-135174265 CTCTTAACACAGAAGAGGCTGGG - Intronic
997773861 5:136580538-136580560 CTAAAAATACAAAAGTAGCTGGG + Intergenic
997776325 5:136610119-136610141 CTAAAAATACAGAATTAGCTGGG + Intergenic
997824663 5:137095949-137095971 CTAATAGCACAGAAGAATCTGGG + Intronic
997993706 5:138568338-138568360 CTAAAAACACAAAAGTGGCTAGG + Intronic
998066214 5:139161080-139161102 CTAAAAACACAAAATTAGCTGGG + Intronic
998089130 5:139352630-139352652 CTAAAAACACAAAAGTAGCCGGG - Intronic
998090305 5:139362703-139362725 CTAAAAATACAAAAAAGGCCAGG - Intronic
998141486 5:139702049-139702071 CTAAAAATACAAAAGTAGCTGGG - Intergenic
998238950 5:140425552-140425574 CAAAAAACAGAAAAGAGGCCTGG - Intronic
998259084 5:140614345-140614367 CTAAAAATACAGAATTAGCTGGG + Intergenic
998826126 5:146103318-146103340 CTAAAAATACAGAATTAGCTGGG - Intronic
998834319 5:146189385-146189407 CTAAAAATACAGAATTAGCTGGG - Intergenic
999157743 5:149470629-149470651 CTAAAAACACAAAATTAGCTGGG - Intergenic
999317227 5:150592002-150592024 CTAAAAATACAAAATTGGCTGGG + Intergenic
999386776 5:151159131-151159153 CTAAAAATACAGAATTAGCTGGG - Intergenic
999488029 5:152019691-152019713 CTCAAAAAACAAAAGAAGCTAGG - Intergenic
1000177272 5:158769727-158769749 CAAAAAAAAAAGGAGAGGCTTGG + Intronic
1000323354 5:160152725-160152747 CTAAAAATACAGAATTAGCTGGG - Intergenic
1000489469 5:161892708-161892730 CAAAAAACACAGGACAGGCCGGG + Intronic
1000558449 5:162756046-162756068 CTAAAAACACAAAATTAGCTGGG - Intergenic
1000569758 5:162897050-162897072 CTTAAAAGCCAGAAGAGACTGGG + Intergenic
1000617585 5:163445751-163445773 TTAAAAAAACATTAGAGGCTAGG - Intronic
1001101657 5:168819294-168819316 CCAAAAACAGAGAGGAGGCTTGG + Intronic
1001260860 5:170227389-170227411 ATGGAAACACAGAAGGGGCTGGG + Intergenic
1001471170 5:172013813-172013835 CTAAAAATACAAAATGGGCTGGG - Intergenic
1001520546 5:172388974-172388996 CTTAGAAGACAGAAGAGTCTGGG + Intronic
1001538199 5:172514548-172514570 CTAAAAACACAAAATTAGCTGGG + Intergenic
1001607749 5:172974943-172974965 CTAAAAAAAAAAAAGAGGCCAGG + Intergenic
1001610999 5:173001877-173001899 CTAAAAACACAAAATAAGCCAGG - Intronic
1001833233 5:174807279-174807301 CTAAAAACACAAAACTAGCTGGG - Intergenic
1001919244 5:175587553-175587575 CTAAAAATACAAAATAGGCTGGG - Intergenic
1002026587 5:176400028-176400050 CTAAAAACACAAAATTAGCTGGG + Intronic
1002145690 5:177179374-177179396 CTAAAAACACAAAATCAGCTGGG - Intronic
1002197004 5:177506848-177506870 CTAAAAATACAGAAGTAGCTGGG - Intronic
1002334048 5:178465945-178465967 CACAAAACACAGTAGAGCCTCGG + Intronic
1002398655 5:178977728-178977750 CTAAAAACACAAAATTAGCTGGG - Intergenic
1002509320 5:179702928-179702950 CTAAAAACACAAAATTAGCTGGG - Intronic
1002562515 5:180091933-180091955 CTCAAAAAACAAGAGAGGCTAGG - Intergenic
1002620407 5:180484130-180484152 AAAAAAACACAAAAAAGGCTGGG + Intergenic
1002971872 6:2031328-2031350 CCTAGAACACAGAAGAGGTTGGG - Intronic
1003148407 6:3528212-3528234 CTAAAAATACAAAATTGGCTGGG - Intergenic
1003594011 6:7458536-7458558 CTAAAAATACAAAATTGGCTGGG + Intergenic
1003692480 6:8368121-8368143 ATTAAAAAACAGAACAGGCTGGG + Intergenic
1003959542 6:11196330-11196352 CAAAAAACCCAGAAGGGGATTGG + Intronic
1004451632 6:15753207-15753229 CTTAAAACACAAAACAGGCCAGG + Intergenic
1004591306 6:17054501-17054523 CTAAAAATACAAAATAAGCTGGG - Intergenic
1004754137 6:18593381-18593403 CTTAAAACAAAGAACAGGCCAGG - Intergenic
1004848956 6:19676633-19676655 CTAAAAACACAAAATTCGCTGGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005206002 6:23405405-23405427 AGAAAAACAGAAAAGAGGCTGGG + Intergenic
1005326835 6:24710423-24710445 CTAAAAACACAAAATTAGCTGGG - Intronic
1005387339 6:25298913-25298935 CTAAAAATACAAAATAAGCTGGG - Intronic
1005436184 6:25814686-25814708 CTAAAAAGACAGAATGGGCTGGG + Intronic
1005523817 6:26625905-26625927 CTAAAAACACAAAATTAGCTGGG + Intergenic
1005753969 6:28909266-28909288 CTAAAAACACAAAATTAGCTGGG - Intronic
1005895489 6:30173707-30173729 CAAAAAACAAAAAACAGGCTAGG + Intergenic
1006073340 6:31512880-31512902 CTAAAAACACAGAACTAGCCGGG + Intergenic
1006085453 6:31591952-31591974 CTAAAAATACAAAAATGGCTGGG + Intronic
1006126470 6:31841968-31841990 CTCAAAAAACAAAAAAGGCTGGG - Intergenic
1006205900 6:32342447-32342469 AAAAGAACAGAGAAGAGGCTGGG - Intronic
1006471028 6:34228709-34228731 TCAAAAACAAAAAAGAGGCTGGG + Intergenic
1006499707 6:34450115-34450137 CTAAAAATACAAAATTGGCTGGG + Intergenic
1006504824 6:34482245-34482267 CTAAAAACACAAAATTAGCTGGG - Intronic
1006515428 6:34542896-34542918 AAAAAAAAAAAGAAGAGGCTGGG + Intronic
1006545369 6:34776557-34776579 TTAAAAAAACAGAAGTGGCCAGG + Intergenic
1006552793 6:34839087-34839109 CTAAAAACACAAAATTAGCTGGG + Intronic
1006554059 6:34850988-34851010 CTAAAAATCAAGCAGAGGCTGGG - Intronic
1006702394 6:35986193-35986215 CTAAAAACACAAAATTAGCTGGG - Intronic
1006769098 6:36536695-36536717 CTAAAAATACAGAATTAGCTGGG - Intronic
1006819101 6:36876561-36876583 CTAAAAATACAAAATAAGCTGGG + Intronic
1006918595 6:37613044-37613066 CTAAAAATACAGAATCAGCTGGG + Intergenic
1006980572 6:38144613-38144635 CTAAAAATACTGATGAGCCTTGG - Intronic
1007002272 6:38325388-38325410 TTAAAAACAACAAAGAGGCTGGG + Intronic
1007058461 6:38912968-38912990 CTAAAAATACAAAACAAGCTGGG - Intronic
1007185524 6:39968215-39968237 ATAAAAAAATAGAAAAGGCTGGG + Intergenic
1007474641 6:42111056-42111078 CTAAGAACACACAGGAGGCCAGG - Intronic
1007533081 6:42560431-42560453 CTAAAAATACAAAAAAAGCTGGG - Intergenic
1007559169 6:42791757-42791779 CTAAAAACCCATCAGAGGCCAGG - Intronic
1007592627 6:43031902-43031924 TAAAAAACATGGAAGAGGCTGGG + Intronic
1007608864 6:43135891-43135913 CTAAAAATACAAAAATGGCTGGG + Intronic
1007910470 6:45508387-45508409 CTAAAAACACAAAATTAGCTGGG - Intronic
1007954752 6:45906721-45906743 CTAAAAACACAAAATTAGCTGGG - Intronic
1008192991 6:48482751-48482773 CTAAAAATACAAAATAAGCTGGG + Intergenic
1008639136 6:53443542-53443564 CTAAAAACACAGAATTAGCCAGG + Intergenic
1008941459 6:57050312-57050334 CTAAAAAAAAAAAAGAGGCATGG - Intronic
1009022522 6:57960050-57960072 ATAAAAAAATAGAAAAGGCTGGG + Intergenic
1009218191 6:60948287-60948309 CTAAAAATACAGAATTAGCTGGG - Intergenic
1009462714 6:63933500-63933522 ATAAAAACCCAAAAGAGGCCAGG - Intronic
1009581874 6:65546730-65546752 CTAAAAATACAAAAGTAGCTGGG - Intronic
1010114470 6:72286034-72286056 CTAAAAATACAAAAGTAGCTGGG + Intronic
1010180478 6:73081149-73081171 GTTTGAACACAGAAGAGGCTTGG + Intronic
1010238329 6:73593767-73593789 TTAAAAACATAGAACAGGCTGGG + Exonic
1010275310 6:73962263-73962285 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1010524556 6:76884954-76884976 CAAAAATCACAAAACAGGCTGGG + Intergenic
1010715386 6:79223214-79223236 CTAAAAATACACACAAGGCTAGG + Intronic
1011072268 6:83398806-83398828 CTAAAAATACAAAAGTGGCCGGG + Intronic
1011421422 6:87177164-87177186 CTAAAAATACAGAATTAGCTGGG + Intronic
1011452585 6:87510711-87510733 CTAAAAATACAAAATTGGCTGGG + Intronic
1011739606 6:90346866-90346888 CTAAAAATAGAGAAGTGGATAGG + Intergenic
1012471524 6:99577704-99577726 ATAAAAACAAAGAAGAGAATTGG - Intergenic
1013131823 6:107240557-107240579 CTAAAAATACAAAAAAAGCTGGG - Intronic
1013143980 6:107369122-107369144 TTTAAAACACAGAACAGGCCGGG + Intronic
1013199516 6:107879484-107879506 CTAAAAATACAAAATTGGCTGGG - Intronic
1013550112 6:111199296-111199318 CTAAAAACACAAAATTAGCTGGG + Intronic
1013791786 6:113845690-113845712 TTAAAGCCACAGTAGAGGCTGGG + Intergenic
1013970675 6:116014835-116014857 CTAGAAACAAAAAAGAGACTTGG + Intronic
1014244919 6:119057828-119057850 AAAAAAACACAGAAGAGAGTTGG - Intronic
1014409300 6:121094460-121094482 ATAAAAATACAGAAGTGGCCAGG - Intronic
1014460868 6:121693870-121693892 CTAAAAATACAGAATTAGCTGGG + Intergenic
1014852707 6:126361588-126361610 ATAGAAATACAAAAGAGGCTGGG - Intergenic
1014983999 6:127980013-127980035 CTAAAAATACAAAAAAGGCCCGG + Intronic
1015098855 6:129450614-129450636 TAAAAAACACAGTTGAGGCTGGG - Intronic
1015335693 6:132035485-132035507 CTAAAAACACAAAATTAGCTGGG + Intergenic
1015559442 6:134498590-134498612 GAAAAAATAAAGAAGAGGCTGGG + Intergenic
1015982236 6:138850838-138850860 CTAAAAACACAAAATTAGCTGGG + Intronic
1016570430 6:145506467-145506489 CTAAAAGCACAGGAAAGGCAAGG + Intronic
1016623597 6:146140562-146140584 CAAAAAACATATAACAGGCTGGG - Intronic
1016825179 6:148381930-148381952 AGAAGAGCACAGAAGAGGCTGGG - Intronic
1016894545 6:149039385-149039407 CTAAAAACACAAAATTAGCTGGG - Intronic
1016934407 6:149438713-149438735 CTAAAAACACAAAATTAGCTGGG - Intergenic
1017001663 6:150001676-150001698 AGAAAAACACAGGAGAGGGTTGG + Intergenic
1017007978 6:150041713-150041735 ATAAACACACAGAAGAAACTGGG + Intergenic
1017060586 6:150481266-150481288 TTAAAAACACAAAATAGACTGGG + Intergenic
1017103689 6:150868498-150868520 CTAAAAACACAAAATAAGCCAGG - Intronic
1017262971 6:152408790-152408812 CTAAAAACACAAAATTAGCTGGG + Intronic
1017318114 6:153055982-153056004 CTAAAAACACTGTTAAGGCTAGG + Intronic
1017385362 6:153876476-153876498 CTAAAAATACAGAATTAGCTGGG + Intergenic
1017505235 6:155062734-155062756 CTAAAAACACAAAATTAGCTGGG - Intronic
1017513373 6:155133876-155133898 CTAAAAACACAAAATCAGCTGGG - Intronic
1017532731 6:155313084-155313106 CTAAAAACACAAAATTAGCTAGG + Intronic
1017895470 6:158675650-158675672 CTAAAAACACAAAAATGGCCGGG + Intronic
1017914560 6:158821076-158821098 CTAAAAATACAGAATTAGCTGGG + Intergenic
1018089141 6:160330376-160330398 ACAAGAAGACAGAAGAGGCTGGG + Intergenic
1018772368 6:166982541-166982563 CTAAAAACACAAAATTAGCTGGG - Intergenic
1018866310 6:167749055-167749077 TTGAAAACACAGGCGAGGCTTGG + Intergenic
1018875492 6:167818986-167819008 CTAAAAACACAAAATTGGCCTGG - Intergenic
1019405273 7:880178-880200 CTAAAAATACAGAATTAGCTGGG + Intronic
1019912006 7:4106457-4106479 CTAAAAATACAAAAAAGGCGTGG - Intronic
1019942947 7:4305625-4305647 AAAATAACACAGAAGAGGCAAGG - Intergenic
1020030649 7:4930342-4930364 CTAAAAAGACAAAACAGGCCGGG + Intronic
1020155743 7:5722683-5722705 TTAAAAAAACATGAGAGGCTGGG - Intronic
1020377960 7:7509127-7509149 CAAAAAAAACAAAATAGGCTGGG - Intronic
1020407497 7:7854192-7854214 CTAAAAATACAGAATTAGCTGGG + Intronic
1020438976 7:8197257-8197279 ATTAAAAAAAAGAAGAGGCTGGG + Intronic
1020474446 7:8579531-8579553 CTAAAAACACAAAATTAGCTGGG - Intronic
1020508918 7:9027918-9027940 TTAAAAAGACAGAAGAAGATTGG + Intergenic
1021074750 7:16288548-16288570 CTGAAAACACAATACAGGCTGGG + Intronic
1021492078 7:21230160-21230182 CTAAAAATACAAAATAAGCTGGG + Intergenic
1021511140 7:21433777-21433799 CTAAAAATACAGAATTAGCTGGG + Intronic
1021586882 7:22218656-22218678 CTAAGGACACAGCAGAGGTTAGG + Intronic
1021720385 7:23499164-23499186 CTAAAAATACAGAATTAGCTGGG - Intergenic
1021741071 7:23686087-23686109 CTAAAAACACTGAGGAGGAATGG + Intronic
1021884028 7:25120961-25120983 CTAAAAACACAAAATAAGCTGGG + Exonic
1022076983 7:26981561-26981583 CTAAAAACACAAAATTAGCTGGG - Intronic
1022406943 7:30099049-30099071 GTAAAAAGAAAGAAAAGGCTGGG - Intronic
1022600343 7:31752255-31752277 CTAAAATCACAGAAGTAGCAAGG - Exonic
1022835697 7:34111872-34111894 CTAAAAATACAGAAGTAGCCAGG - Intronic
1023064333 7:36361593-36361615 CTAAAAACTCAAAAGAAGCTAGG + Intronic
1023697337 7:42861293-42861315 CTAAAAACACACAAGAAACTAGG - Intergenic
1023917954 7:44604563-44604585 CTAAAAATACAAAATAAGCTGGG + Intergenic
1023930631 7:44703422-44703444 CAAAAAAGACTGAATAGGCTGGG + Intronic
1023936467 7:44743558-44743580 CTAAAAATACAGAATTAGCTGGG - Intergenic
1024636154 7:51291998-51292020 CTGAAAACACAAAATTGGCTGGG + Intronic
1024980857 7:55156376-55156398 CAACAAACACTGAAGGGGCTGGG - Intronic
1025081868 7:55990524-55990546 CTAAAAACAAAAAACAGGCTAGG - Intronic
1025247333 7:57327201-57327223 CTAAAGACCCAGGAGGGGCTGGG + Intergenic
1025296597 7:57780074-57780096 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1025616140 7:63118753-63118775 CTAAAAACACAAAATAAGCCGGG + Intergenic
1025779224 7:64584818-64584840 CTAAAAACACAAAATTAGCTGGG - Intergenic
1025830213 7:65042553-65042575 CTAAAAACACAAAACGAGCTGGG + Intergenic
1025917372 7:65876339-65876361 CTAAAAATACAAAACAAGCTGGG + Intronic
1026022863 7:66723739-66723761 CTAAAAATACAAAAGTGGCCAGG - Intronic
1026059666 7:67014993-67015015 AAAAAAAAACAGAAGAGGCCGGG - Intronic
1026073568 7:67144763-67144785 TTAAAAACAAAGAGGAGGCCAGG - Intronic
1026179561 7:68026979-68027001 CTAAAAATACAAAATTGGCTGGG + Intergenic
1026262949 7:68771442-68771464 CTAAAAACACAAAATTAGCTGGG + Intergenic
1026302084 7:69106909-69106931 CTAAAAACACAAAATTTGCTGGG - Intergenic
1026347604 7:69488113-69488135 CTAAAAATACAAAATAAGCTGGG - Intergenic
1026451652 7:70534585-70534607 CTAAAAATACAGAATTAGCTGGG - Intronic
1026569886 7:71520360-71520382 CTAAAAACACAAAATTAGCTGGG + Intronic
1026619417 7:71937144-71937166 CTAAAAATACAAAAGTAGCTGGG + Intronic
1026637176 7:72094413-72094435 CTAAAAATACAGAATTAGCTGGG - Intronic
1026703317 7:72667417-72667439 TTAAAAACAAAGAGGAGGCCAGG + Intronic
1026718430 7:72810010-72810032 AAAAAAACACAGAAGAGGCTGGG + Intronic
1026820800 7:73547000-73547022 CTAAAAATACAAAAGTAGCTGGG + Intronic
1026864516 7:73815137-73815159 CTAAAAATACAAAATTGGCTGGG + Intronic
1026887961 7:73965585-73965607 CTAAAAACACAAAATTAGCTGGG - Intergenic
1027148261 7:75713859-75713881 CTAAAAATACAAAAAATGCTGGG - Intronic
1027365448 7:77452864-77452886 ATATAAACACAAAAGAGGCCTGG + Intergenic
1027461653 7:78461748-78461770 CTAAAAACACAAAATTAGCTGGG + Intronic
1027628273 7:80571118-80571140 CAAAAGAAACAGAATAGGCTGGG - Intronic
1028201511 7:87967513-87967535 TTAAAAAAACAGTATAGGCTGGG + Intronic
1028465337 7:91145163-91145185 CTTAAAACACTGAAGAGAATAGG - Intronic
1028613512 7:92738476-92738498 CTAAAAACACAAAATTAGCTGGG + Intronic
1028688346 7:93619579-93619601 CTAAGAACAAAGCAGAGGCCTGG - Intronic
1028966960 7:96812839-96812861 CTAAAAACACTGAATAAACTAGG + Intergenic
1029111414 7:98214683-98214705 CTGAAAGCCCAGAAGAGCCTCGG + Exonic
1029212581 7:98920998-98921020 CTAAAAACACAAAATTAGCTGGG - Intronic
1029266904 7:99349541-99349563 CTAAAAATACAAAAGAGGCCGGG + Intronic
1029268879 7:99364431-99364453 CTAAAAACACAAAATTAGCTGGG - Intronic
1029364936 7:100110648-100110670 CTAAAAACACAAAATTAGCTGGG + Intronic
1029542870 7:101194794-101194816 TTAAGAACACAGCTGAGGCTGGG - Intergenic
1029668476 7:102011541-102011563 CTAAAAACACAAAATTAGCTGGG - Intronic
1029689112 7:102169092-102169114 CTAAAAACACAAAATGAGCTGGG - Intronic
1029853729 7:103491666-103491688 CTAAAAATACAAAATAAGCTGGG + Intronic
1029936163 7:104426415-104426437 CTAAAAACACAAAATTAGCTGGG - Intronic
1030031584 7:105374768-105374790 CTAAAAACACAAAAATAGCTGGG - Intronic
1030226682 7:107159663-107159685 CTGAAATCACAGAAAATGCTTGG - Exonic
1030243001 7:107349851-107349873 CTAAAAATACAAAAAAGACTGGG - Intronic
1030352058 7:108500746-108500768 CTAAAAATACAAAAGTAGCTGGG + Intronic
1031135459 7:117879252-117879274 ATAAAAACACAAAACTGGCTGGG - Intergenic
1031229646 7:119089200-119089222 CTAAAAACATAGATGAATCTGGG - Intergenic
1031331945 7:120476234-120476256 CTAATAACACAGAAGAGAAAAGG - Intronic
1032215910 7:129956878-129956900 CTAAAAATACAAAATAGGCATGG + Intergenic
1032442312 7:131951329-131951351 CTAAAAATACAGAATTAGCTGGG + Intergenic
1032731600 7:134648294-134648316 CTAAAAACACAAAATTAGCTGGG - Intronic
1032754719 7:134878271-134878293 CTAAACACACAGGACAGGCTGGG + Intronic
1032776623 7:135120906-135120928 ATAAAATCACAGAACTGGCTGGG + Intronic
1033058459 7:138081741-138081763 CTAAAAATACAGAATTAGCTGGG - Intronic
1033069747 7:138191282-138191304 CTAAAAACACAAAATTAGCTGGG + Intergenic
1033117121 7:138635109-138635131 CTAAAAACACAAAATTAGCTGGG + Intronic
1033118088 7:138644038-138644060 CTAAAAACACAAAAATAGCTGGG + Intronic
1033198430 7:139347424-139347446 CTAAAAATACAGAATTAGCTGGG + Intronic
1033302495 7:140198953-140198975 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1033319874 7:140329864-140329886 CTAAAGGCACAGAAGAGGCAAGG + Intronic
1033545199 7:142393241-142393263 CTAAAAACACAAAACTGGCCAGG - Intergenic
1033608507 7:142944405-142944427 AGAGAGACACAGAAGAGGCTAGG + Intronic
1033619390 7:143048822-143048844 TTGAAAGCAAAGAAGAGGCTGGG - Intergenic
1034260892 7:149754785-149754807 CAAAAAAGCCAAAAGAGGCTGGG - Intergenic
1034583964 7:152072156-152072178 CTAAAAACACAAAATTAGCTGGG + Intronic
1035150464 7:156866895-156866917 CTAAAAACTCATAAGAGGCTGGG - Intronic
1035235632 7:157496108-157496130 CTAAAAACACAGAATCAGCTGGG - Intergenic
1035445693 7:158941584-158941606 AAAAAAACAAAAAAGAGGCTGGG + Intronic
1035453029 7:158991198-158991220 CTAAAAATACAAAATTGGCTGGG + Intergenic
1035514823 8:223747-223769 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1035515098 8:226082-226104 CTAAAAATACAAAATTGGCTGGG + Intergenic
1035585762 8:772194-772216 TTAAAATTACAGATGAGGCTGGG - Intergenic
1035819234 8:2574038-2574060 CTAAAGACACACAGGAGACTGGG - Intergenic
1035829180 8:2676152-2676174 TTAAAAACACAGGGGAGGCCAGG - Intergenic
1035847386 8:2879947-2879969 CAAAAAACAGAAAAGTGGCTGGG - Intergenic
1035999099 8:4582063-4582085 CCAAAAAAAAAAAAGAGGCTCGG - Intronic
1036379169 8:8225971-8225993 CTAAAAATACAAAAGTGGCCCGG + Intergenic
1036387246 8:8293199-8293221 CTAAAAACACAAAATTAGCTGGG - Intergenic
1036597953 8:10231079-10231101 TTAAAACTACAGAACAGGCTGGG - Intronic
1036599051 8:10242108-10242130 CTAAAAACACAGAATTAGCCGGG + Intronic
1036850390 8:12196640-12196662 CTAAAAATACAAAAGTGGCCAGG - Intergenic
1036871755 8:12438913-12438935 CTAAAAATACAAAAGTGGCCCGG - Intergenic
1037004184 8:13756938-13756960 CTAAAAATACAAAATAAGCTGGG - Intergenic
1037523640 8:19703600-19703622 CTAAAAACAAAGAGAGGGCTGGG - Intronic
1037565365 8:20113268-20113290 TTAAGAAAACAGAATAGGCTGGG - Intergenic
1038126381 8:24677881-24677903 CAATAAATAGAGAAGAGGCTGGG + Intergenic
1038287781 8:26221184-26221206 TTAAAAAGACAAAACAGGCTGGG + Intergenic
1038719523 8:30021459-30021481 AAAGAAACACAGAGGAGGCTGGG + Intergenic
1038738866 8:30198984-30199006 CTGAAAACATGGAAGAGGTTGGG - Intergenic
1038777253 8:30542287-30542309 ATAAAAACAGAGAAAAGTCTGGG + Intronic
1038947302 8:32375271-32375293 CTAAAAATGCTGATGAGGCTGGG - Intronic
1039067181 8:33618950-33618972 CTAAAAACACAAAATTAGCTGGG - Intergenic
1039195689 8:35028970-35028992 TTCATAACACAGAAGATGCTGGG + Intergenic
1039425769 8:37484725-37484747 ATAAAAACACATTAGAGGATGGG - Intergenic
1039506600 8:38056956-38056978 TGAAAAACCCAGAGGAGGCTGGG - Intronic
1039512310 8:38101964-38101986 CTAAAAACACAAAATTAGCTGGG + Intergenic
1039557545 8:38487416-38487438 CTAAAAAAGTAGATGAGGCTGGG - Intergenic
1039942341 8:42101993-42102015 CTAAAAATACAGAATTAGCTGGG + Intergenic
1039975703 8:42362961-42362983 CTAAAAACACAAAATTGGCCGGG + Intronic
1040483059 8:47843710-47843732 CTTAAAAACCAGAAGAGACTGGG + Intronic
1040970792 8:53135628-53135650 CTAAAAATACAAAAGTGGCCAGG + Intergenic
1041242869 8:55863342-55863364 AAAAAAACAAAAAAGAGGCTGGG + Intergenic
1041252123 8:55944774-55944796 TTAAAAACAAAAAACAGGCTGGG - Intronic
1041484993 8:58366100-58366122 CCAAAAAGACAAAAGAGACTAGG + Intergenic
1041534575 8:58911861-58911883 CTAAAAATACAAAAGTCGCTGGG - Intronic
1041675703 8:60537380-60537402 CTAAAAACACAAAATTAGCTGGG - Intronic
1041734659 8:61097063-61097085 TTAAAAACACAGCATAGGCTGGG + Intronic
1041930469 8:63280865-63280887 CTAAAAACACAAAATAAGCCAGG + Intergenic
1042090565 8:65154689-65154711 ATATAAACATAGAATAGGCTGGG + Intergenic
1042263184 8:66881523-66881545 CTAAAAATACAAAAGTAGCTGGG + Intronic
1042326113 8:67529602-67529624 CACAGGACACAGAAGAGGCTGGG + Intronic
1042562700 8:70085069-70085091 CTAAAAATACAAAATAAGCTGGG - Intergenic
1042563437 8:70090804-70090826 CTAAAAACACAAAATTAGCTGGG - Intergenic
1042810542 8:72821120-72821142 ACAAAAACACAGAAGAGGTTGGG + Intronic
1042835003 8:73071779-73071801 CTACACACACAGAGGATGCTGGG - Exonic
1042863726 8:73338443-73338465 TTAAAACCACAAAAGAGGCTGGG + Intergenic
1042943641 8:74132592-74132614 CTAAAAACACAAAATTAGCTGGG - Intergenic
1043420345 8:80091173-80091195 TAAAATACACAAAAGAGGCTGGG + Intronic
1043608344 8:82030231-82030253 CTTAAAAAACAGAATAGGCCAGG - Intergenic
1043789338 8:84444031-84444053 TAAAAAACACAAAACAGGCTGGG + Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044110589 8:88268179-88268201 CTAAAAATACAAAAGTAGCTGGG + Intronic
1044234800 8:89818625-89818647 CTAAAAATACAAAAATGGCTGGG + Intergenic
1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG + Intronic
1044339818 8:91033938-91033960 TTAAAAACAAGGAGGAGGCTGGG - Intronic
1044676240 8:94731574-94731596 CTAAAAATACAAAACTGGCTGGG - Intronic
1044718821 8:95126113-95126135 CTAAAAACACAAAATTAGCTGGG + Intergenic
1044752900 8:95433047-95433069 CTAAAAACACACAATTAGCTGGG + Intergenic
1045303698 8:100937967-100937989 CTAAAAATACAGAATTAGCTGGG + Intronic
1045793779 8:106018703-106018725 TTAAAAAGGCAGAAGTGGCTGGG + Intergenic
1045872096 8:106938957-106938979 CTAAATACACAAAAGGAGCTGGG - Intergenic
1045922718 8:107550222-107550244 CTAAAAAAACACAATAGTCTTGG - Intergenic
1046433234 8:114154864-114154886 CTAAAAACACTGAATAAACTAGG - Intergenic
1046544869 8:115637192-115637214 CAAGAAACAGAGAAGAAGCTAGG + Intronic
1046548289 8:115679823-115679845 ATAAAATCACAGATGTGGCTGGG + Intronic
1046697707 8:117360514-117360536 ATGAAAAATCAGAAGAGGCTGGG + Intergenic
1046780332 8:118208094-118208116 CTAAAAACACAAAATTAGCTGGG + Intronic
1046964573 8:120149853-120149875 CTAAAAACACAAAATTAGCTGGG - Intronic
1047136499 8:122084929-122084951 TTTAAAACATAGAAGAGGCCGGG + Intergenic
1047237629 8:123056237-123056259 TTAAAAACAAAAAAGAGGCCAGG + Intronic
1047258425 8:123234471-123234493 TTAAAAATACAAAAAAGGCTGGG + Intronic
1047396570 8:124505221-124505243 CTAAAAACACAAAATTAGCTGGG + Intronic
1047491173 8:125375870-125375892 CTAAAAACACAAAATTAGCTGGG + Intergenic
1047602877 8:126444388-126444410 CTAAAAACACAAAATTAGCTGGG - Intergenic
1047701828 8:127456667-127456689 CTAAAAATACAAAAAAAGCTGGG - Intergenic
1047743569 8:127827154-127827176 CTAAAAACACAAAATTAGCTGGG - Intergenic
1047890719 8:129305415-129305437 ATAAAAACACTCAAGAAGCTAGG - Intergenic
1047953486 8:129955090-129955112 CTAAAAACACAAAATTAGCTGGG + Intronic
1048063363 8:130943463-130943485 CTAAACACAGGGAAGAGGGTGGG + Intronic
1048079551 8:131110590-131110612 CTAAAAATACAGAATTAGCTGGG - Intergenic
1048939398 8:139385258-139385280 CTAAAAATACCGCAAAGGCTTGG + Intergenic
1049122158 8:140748330-140748352 CTAAAAATACAGAATTAGCTGGG + Intronic
1049185354 8:141248718-141248740 ATAAAAAAACAAAACAGGCTAGG + Intronic
1049631223 8:143658901-143658923 CTAAAAATACAAAATAAGCTGGG - Intergenic
1050238229 9:3605716-3605738 CTAAAAATACAGAATTAGCTGGG - Intergenic
1050352577 9:4754396-4754418 CTAAAAACACAAAAGTAGCTGGG + Intergenic
1050553012 9:6763916-6763938 CTAAAAACACAAAATTAGCTGGG - Intronic
1050597214 9:7216031-7216053 ATAAAAGCAAAGAGGAGGCTGGG - Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051161837 9:14217497-14217519 CTAAAAATACAAAATTGGCTGGG + Intronic
1051200511 9:14616154-14616176 ATTAAAACACAGAAAATGCTTGG + Exonic
1051439324 9:17067132-17067154 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1051461875 9:17327790-17327812 CTAAAAATACAAAAGTAGCTGGG + Intronic
1051577768 9:18636747-18636769 CTATAAACAAAGAAGAGGATGGG + Intronic
1051625829 9:19099459-19099481 TTAAAAACAAAAAAGAGGCCGGG - Intronic
1051639989 9:19215732-19215754 CTAAAAACACAAAATTAGCTGGG + Intergenic
1051752281 9:20355401-20355423 CTTAAAACACAGAAGATAGTCGG - Intronic
1051809051 9:21030143-21030165 TTAAAAAAACAAAACAGGCTGGG + Intronic
1052242583 9:26292030-26292052 CTAAAAACACAAAATTAGCTGGG - Intergenic
1052448726 9:28598058-28598080 TTAAAAATACAAAATAGGCTGGG - Intronic
1052644617 9:31217126-31217148 CTAAAAACACAAAATTAGCTGGG + Intergenic
1052794492 9:32910808-32910830 CTAAAAATACAAAACAGGCCAGG + Intergenic
1052975090 9:34404312-34404334 CTACAAAAACTGAAAAGGCTTGG + Intronic
1053012175 9:34640170-34640192 CAAAAAAAACAAAACAGGCTGGG + Intronic
1053120604 9:35544599-35544621 ATAAAAAGACATACGAGGCTGGG - Intronic
1053134959 9:35645036-35645058 CTAAAAACACAAAATAAGCCGGG + Intronic
1053659279 9:40255112-40255134 CTAAAAACACAAAATTAGCTGGG + Intronic
1053909649 9:42884478-42884500 CTAAAAACACAAAATTAGCTGGG + Intergenic
1054371405 9:64401413-64401435 CTAAAAACACAAAATTAGCTGGG + Intronic
1054525320 9:66121110-66121132 CTAAAAACACAAAATTAGCTGGG - Intronic
1054679026 9:67891131-67891153 CTAAAAACACAAAATTAGCTGGG + Intronic
1054984415 9:71245151-71245173 ATAAATACAAAGAAGAGGCTGGG + Intronic
1055269755 9:74544665-74544687 GTAAAAACACAGAGGAGGGCTGG - Intronic
1055364581 9:75528798-75528820 CTCAAAAAAAAGAAAAGGCTGGG - Intergenic
1055525327 9:77128033-77128055 TTAAAAATACAAAAAAGGCTGGG - Intergenic
1055550657 9:77429439-77429461 CCACAAAAACAGAATAGGCTCGG - Intronic
1056120266 9:83480654-83480676 CTAAAAAGACAGAATTAGCTGGG - Intronic
1056176196 9:84038619-84038641 CTAAAAACACTGAATAAACTAGG - Intergenic
1056202665 9:84291495-84291517 CTAAAAACACAAAATTAGCTGGG - Intronic
1056234335 9:84577010-84577032 CTAAAAATACAGAATTAGCTGGG + Intergenic
1056530150 9:87479651-87479673 CTAAAAATACAAAACCGGCTGGG - Intergenic
1056555028 9:87681115-87681137 CTAAAAACACAAAATTAGCTGGG + Intronic
1056616102 9:88167259-88167281 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1056991347 9:91414362-91414384 CTAAAAATACAAAAGTAGCTGGG - Intronic
1057050718 9:91921700-91921722 CTAAAAACACAAAAGTAGCCAGG + Intronic
1057062974 9:92021818-92021840 CTAAAAACACAAAATTAGCTAGG - Intergenic
1057116294 9:92525593-92525615 ATAAAAATACAGCACAGGCTGGG + Intronic
1057244594 9:93444199-93444221 CTAAAAACACAAAATTAGCTGGG - Intergenic
1057352669 9:94313648-94313670 CTAAAAACATGGATGAAGCTTGG + Intergenic
1057449789 9:95147353-95147375 CTAAAAACACAAAATTAGCTGGG + Intronic
1057458396 9:95235681-95235703 CTAAAAATACAAAATTGGCTGGG + Intronic
1057511531 9:95683687-95683709 CTAAAAATACAAAGGAGGCTGGG + Intergenic
1057602249 9:96468552-96468574 CTAAAAATACAAAAAAGGCCGGG - Intronic
1058027968 9:100162929-100162951 CTAAAAGCCTAGAAGAGGATGGG + Intronic
1058405821 9:104673143-104673165 CTAAAAACACACAAAAGGCCAGG + Intergenic
1058411053 9:104731992-104732014 CTAAAAACACAAAATTAGCTGGG + Intergenic
1058417500 9:104803766-104803788 CTAAAAATACAAAATAAGCTGGG - Intronic
1058531086 9:105905215-105905237 CTAAAAACACAAAATTAGCTGGG + Intergenic
1058547046 9:106071924-106071946 CCAAAAACAAACTAGAGGCTGGG + Intergenic
1058877423 9:109256779-109256801 CTAAAAATACAGAATTCGCTGGG + Intronic
1058899054 9:109425715-109425737 CAAAAAAGAGAGAATAGGCTGGG + Intronic
1059303828 9:113338777-113338799 CTAAAAACACAAAATTAGCTGGG - Intronic
1059304869 9:113346328-113346350 ATAAAAAGAAAGAAAAGGCTGGG - Intergenic
1059448339 9:114353557-114353579 CTTAAAACAGAAATGAGGCTGGG - Intronic
1059531440 9:115039130-115039152 CTCAAAGCTCAGAAAAGGCTCGG - Intronic
1059583568 9:115579476-115579498 CTAAAAATACAAAATAAGCTGGG + Intergenic
1059731242 9:117059316-117059338 ATAAAAACACAGAATAGGCCAGG + Intronic
1060010946 9:120042327-120042349 CTAAAAATACAAAATAAGCTGGG + Intergenic
1060082086 9:120658280-120658302 TTAAAAATGTAGAAGAGGCTGGG - Intronic
1060086764 9:120710265-120710287 CTAAAAACACAAAATTAGCTGGG + Intronic
1060093928 9:120770079-120770101 ATAAAAACAATGAAGAGGCCGGG + Intronic
1060095904 9:120790181-120790203 TTAAAAACACACACCAGGCTGGG + Intronic
1060493947 9:124104420-124104442 CTAAAAACACAAAATTAGCTGGG - Intergenic
1060923836 9:127441648-127441670 CTAAAAATACAAAATTGGCTGGG + Intronic
1060930358 9:127485941-127485963 CTAACAGCAGAGCAGAGGCTGGG - Intronic
1061038498 9:128126561-128126583 CTTAAAACACGGTAGAGGCTGGG + Intronic
1061089163 9:128417198-128417220 CTAAAAACACAAAATTAGCTGGG - Intronic
1061125871 9:128675336-128675358 CTAAAAATACAAAATTGGCTGGG - Intergenic
1061172250 9:128965956-128965978 CTAAAAATACAAAAAAAGCTGGG - Intronic
1061197848 9:129117698-129117720 CTTAAAAAAAAAAAGAGGCTGGG - Intronic
1061345014 9:130016580-130016602 CTAAAAACACAAAATTAGCTGGG + Intronic
1061460041 9:130730201-130730223 CTAAAAACACAAAATTAGCTGGG - Intronic
1061529669 9:131200546-131200568 CTAAAAACACAAAATTAGCTGGG + Intronic
1061639625 9:131942118-131942140 TTAAAAAATCAGCAGAGGCTGGG - Intronic
1061686646 9:132285885-132285907 AAAAAAACACAAAAGAGGCCAGG + Intronic
1061898608 9:133661640-133661662 CTAAAAACACAAAATTAGCTGGG - Intergenic
1062104075 9:134743174-134743196 CTTAAAACACAGGAGTGCCTGGG - Intronic
1062488791 9:136794284-136794306 CTAAAAATACAGAATTAGCTGGG - Intronic
1062547770 9:137071289-137071311 CTGGAAACACAGCAGAGGCAGGG - Intergenic
1062593657 9:137287585-137287607 TTAAAAAAAGAAAAGAGGCTGGG - Intergenic
1062657299 9:137610856-137610878 CTAAAAATACAAAAAAGGCCGGG - Intronic
1062659590 9:137622418-137622440 CTAGAAAGACAGAAGATGATCGG - Intronic
1203691348 Un_GL000214v1:45906-45928 CTAAAAACACAAAATTAGCTGGG - Intergenic
1203730799 Un_GL000216v2:87823-87845 CTAAAAATACAAAATTGGCTGGG - Intergenic
1203752040 Un_GL000218v1:88897-88919 CTAAAAACACAAAATTAGCTGGG + Intergenic
1203710720 Un_KI270742v1:94869-94891 CTAAAAACACAAAATTAGCTGGG + Intergenic
1203540332 Un_KI270743v1:82581-82603 CTAAAAACACAAAATTAGCTGGG - Intergenic
1203644947 Un_KI270751v1:58285-58307 CTAAAAACACAAAATTAGCTGGG + Intergenic
1185602456 X:1349605-1349627 TAAAAAACAAAGAAGAGGCCAGG - Intronic
1185682769 X:1902111-1902133 CTCAAAAAAAAAAAGAGGCTGGG - Intergenic
1185730124 X:2454949-2454971 CTAAAAACACAAAATTAGCTGGG + Intronic
1185880876 X:3739859-3739881 TTAAAAAGAAAGAAGAGGCTGGG + Intergenic
1187072036 X:15898150-15898172 TTTAAAAAATAGAAGAGGCTGGG + Intergenic
1187156919 X:16728740-16728762 ATAAAGACACAGTTGAGGCTGGG + Intronic
1187909341 X:24096350-24096372 TTAAAAAAATAAAAGAGGCTGGG - Intergenic
1187923871 X:24232723-24232745 TTAAAAACACAGTGCAGGCTGGG - Intergenic
1188348884 X:29102503-29102525 CTAAAAATACAGAATTAGCTGGG + Intronic
1188504693 X:30869353-30869375 CAAAAAACAAACAAAAGGCTGGG - Intronic
1189481242 X:41393935-41393957 CTAAAAATACAAAATTGGCTGGG - Intergenic
1189501627 X:41566044-41566066 CTAAAAACTCAGAATAAGCTAGG + Intronic
1189873841 X:45413611-45413633 ATAAAAACACTCAAGAGACTGGG - Intergenic
1189915965 X:45856147-45856169 CTAAAAATACAAAATTGGCTGGG + Intergenic
1190040147 X:47064728-47064750 CTAAAATCACAGCATAGGCAGGG - Intergenic
1190081928 X:47363417-47363439 TTAGAAACACAAAAGAAGCTGGG + Intergenic
1190591380 X:52006045-52006067 CTAAAAACACAAAATTAGCTGGG - Intergenic
1190715573 X:53100317-53100339 CTAAAAATACAAAATTGGCTGGG + Intergenic
1190719842 X:53138499-53138521 CTAAAAATACAGAATTAGCTGGG + Intergenic
1190876565 X:54464426-54464448 ATAAACACACAGTAGAGGCCGGG - Intronic
1190895835 X:54617146-54617168 CTAAAGAAACAGAAGAGGATGGG - Intergenic
1191174148 X:57482018-57482040 CTGAAAGCACTGAGGAGGCTGGG - Intronic
1191174281 X:57482836-57482858 CCCAAAACTCAGAAGAGACTGGG - Intronic
1192075296 X:67989108-67989130 CTGAAAACTCAGAAGAGGAATGG + Intergenic
1192107869 X:68333472-68333494 CTAAAAATACAGAATTAGCTGGG + Intronic
1192408315 X:70909448-70909470 CTAAAAACACAAAATTAGCTGGG + Intergenic
1192485738 X:71524547-71524569 CAAAAAACAGAGAAAAAGCTGGG + Intronic
1192707155 X:73538525-73538547 TCAAAAAGACAAAAGAGGCTGGG + Intergenic
1192791629 X:74387861-74387883 TTAAAAATGAAGAAGAGGCTGGG + Intergenic
1192805784 X:74507249-74507271 AAAAAATCACAGATGAGGCTGGG - Intronic
1192890778 X:75388769-75388791 TTAAAAGCATAGAAGAGACTGGG + Intronic
1192994332 X:76496586-76496608 CTAAAAACACTGAATAAACTAGG + Intergenic
1193090296 X:77486740-77486762 CTAAAAATACAAAATAAGCTGGG + Intergenic
1193222977 X:78948620-78948642 CTAGAGACTCAGAAGAGGGTGGG - Intronic
1193232437 X:79064232-79064254 CTAAAAATACAGAATTAGCTGGG - Intergenic
1193262087 X:79419891-79419913 ATATAAACAAAGAAGAGTCTTGG + Intergenic
1194248297 X:91541386-91541408 CTAAAAATACAAAATTGGCTGGG + Intergenic
1194391999 X:93330408-93330430 CTAAAAATACAGAATTAGCTGGG - Intergenic
1194524883 X:94966839-94966861 CAAAAACACCAGAAGAGGCTGGG + Intergenic
1194675669 X:96790831-96790853 CCAAAACCACTGAAGAGCCTGGG - Intronic
1195242570 X:102967225-102967247 CTAAAAATACAAAATAAGCTGGG - Intergenic
1195397661 X:104428651-104428673 CTAAAAATACAAAATTGGCTGGG + Intergenic
1195621881 X:106964846-106964868 CTAAAAATACAAAAGTAGCTGGG + Intronic
1195664561 X:107417008-107417030 CTAGACACACAGAAGAGGAGAGG + Intergenic
1195711938 X:107780037-107780059 CTAAAAATTCAGGGGAGGCTGGG - Intronic
1196084571 X:111671539-111671561 CTAAAAACACAAAATTAGCTGGG - Intronic
1196188702 X:112772469-112772491 CTAAAAACACAAAATTAGCTGGG - Intergenic
1196200709 X:112882820-112882842 CTCCAGACACAGAAGAGACTTGG - Intergenic
1196677127 X:118431462-118431484 CTAAAAACACAGTATTAGCTGGG - Intronic
1196841945 X:119867131-119867153 CAAAATTCACAGAAAAGGCTGGG + Intergenic
1196928341 X:120656265-120656287 ATAAAATCACAGCAGAGGCTGGG - Intergenic
1196995944 X:121383953-121383975 CTAAAAATACAAAATTGGCTGGG + Intergenic
1197215869 X:123866232-123866254 CTTAAAATACAAAAAAGGCTGGG - Intronic
1197217915 X:123883655-123883677 CTAAAAACACAAAATTAGCTGGG - Intronic
1197351114 X:125384549-125384571 AAAAAAAGGCAGAAGAGGCTGGG + Intergenic
1197400540 X:125983958-125983980 CTAAAAACAAAGGAAAGGGTTGG + Intergenic
1197799647 X:130336078-130336100 ATAAAAACACAAAAGAGGTTGGG - Intergenic
1198188437 X:134278927-134278949 CGAAAAACATAGGAGAGGCCAGG - Intergenic
1198306688 X:135390836-135390858 CTAAAAACACCCATGAGTCTTGG + Intergenic
1198446411 X:136721265-136721287 ATAAAAACACAATGGAGGCTGGG + Intronic
1198736806 X:139794769-139794791 CTAAAAACAGATAAGATGCCCGG - Intronic
1198838150 X:140826536-140826558 CTAAAAACACAAAATTAGCTGGG - Intergenic
1198951334 X:142075861-142075883 CTAAAAACACAAAATTAGCTGGG + Intergenic
1199368530 X:147017942-147017964 CTAAAAACACAAAAATAGCTGGG - Intergenic
1200203559 X:154299314-154299336 CTAAAAACACAAAATTAGCTGGG - Intronic
1200225712 X:154416234-154416256 CTAAAAACACAAAATTAGCTGGG + Intronic
1200244342 X:154515113-154515135 CTAAAAACACACTACAGGCCGGG - Intronic
1200248221 X:154537452-154537474 CTAAAAATACAAAATTGGCTGGG + Intronic
1200360660 X:155603031-155603053 CCAAAATCAAAGCAGAGGCTGGG + Intronic
1200567309 Y:4782906-4782928 CTAAAAATACAAAATTGGCTGGG + Intergenic
1200794832 Y:7331468-7331490 CTAAAAATACAAAATAAGCTGGG - Intergenic
1200842485 Y:7796794-7796816 CAGAAAACACAGCAGTGGCTAGG - Intergenic
1201165695 Y:11206520-11206542 CTAAAAACACAAAATTAGCTGGG + Intergenic
1201224397 Y:11803966-11803988 GTTAAAAAACAGTAGAGGCTGGG + Intergenic
1201602058 Y:15741959-15741981 TTAAAAAGAAAAAAGAGGCTGGG + Intergenic
1201950506 Y:19558530-19558552 CTAAAAACACAAAATTAGCTGGG + Intergenic
1202046317 Y:20739898-20739920 CTAAAAACACAAAATTAGCTGGG + Intergenic
1202065635 Y:20936634-20936656 CTAAAAAGAAAGACGAGGCAGGG + Intergenic
1202088693 Y:21165564-21165586 CTAAAAACACAAAATTAGCTGGG - Intergenic