ID: 963826082

View in Genome Browser
Species Human (GRCh38)
Location 3:149955468-149955490
Sequence GATTTCTTGGGAACTGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963826078_963826082 -5 Left 963826078 3:149955450-149955472 CCTGTTGTATTTTGTTGAGATTT 0: 1
1: 0
2: 3
3: 36
4: 487
Right 963826082 3:149955468-149955490 GATTTCTTGGGAACTGGTACAGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963826082 Original CRISPR GATTTCTTGGGAACTGGTAC AGG Intronic
900234761 1:1582938-1582960 GATTTCTTGGGTTCTGGGCCTGG - Intergenic
906823946 1:48958657-48958679 GATTTCTTAGTACCTGGGACTGG + Intronic
907146999 1:52243922-52243944 CACTCCTTGGCAACTGGTACTGG - Intronic
908225610 1:62053090-62053112 GCTTACTTGGGAACTGGGAGTGG - Intronic
920840193 1:209547497-209547519 TATTTCTTGGGACCAGGAACTGG - Intergenic
921860013 1:220032768-220032790 GGTTTCTTGGGACCTGGTGAGGG + Intronic
922271663 1:224041395-224041417 GATTTCTTGGGAGCAGGGAAGGG - Intergenic
924227607 1:241934743-241934765 CATTTCATGGGAAATGGTCCTGG + Intergenic
1063478987 10:6354652-6354674 GAATGCTTGGGAACTGGGACTGG + Intergenic
1069347316 10:67485298-67485320 GCTTTCTTGGGGACTAGTAGAGG + Intronic
1072617625 10:97060048-97060070 GCTTCCTGGGGAGCTGGTACAGG - Intronic
1073497846 10:103910562-103910584 GATGTCTTGGGAACTGTCATTGG - Exonic
1079071705 11:17352805-17352827 GCTTTTTTGGGAACTCGTATGGG + Intronic
1082110932 11:48273021-48273043 CTTTTCCTGGGAACTGGTAGGGG - Intergenic
1083836637 11:65273402-65273424 GCATCCTTGAGAACTGGTACTGG + Intronic
1086154899 11:83654904-83654926 GATGTCTTGGGGACTGGTCCAGG + Intronic
1086865401 11:91973645-91973667 AATTTCTTTGGAACTGGAATGGG - Intergenic
1087024417 11:93635782-93635804 TATTTATTGGGAACTGCTATAGG - Intergenic
1089010447 11:115127879-115127901 GATTTCATGTGAACTGGAGCCGG - Intergenic
1093456203 12:19367206-19367228 GATTTTTTGGGAACAGGGATGGG + Intronic
1101345952 12:103886302-103886324 GGTTTTTTGGGAACTCTTACAGG + Intergenic
1101456813 12:104841135-104841157 GATTTCTGGGGAAGTGGAAGTGG - Intronic
1103612459 12:122132351-122132373 GGGTTGTTGGGATCTGGTACAGG - Exonic
1107982232 13:45744732-45744754 AAATTTTTGAGAACTGGTACAGG + Intergenic
1108644471 13:52412566-52412588 GTTTTGTTGGGCACTGGTAGTGG - Intergenic
1109359600 13:61279052-61279074 GATTTTGTGGGAGCTGGTAGAGG - Intergenic
1109583703 13:64371838-64371860 GTTTTCTTGGGAAGTGAGACTGG - Intergenic
1110555298 13:76852928-76852950 TGTTTCTCAGGAACTGGTACAGG - Intergenic
1114444784 14:22780124-22780146 TATATCTTGGTGACTGGTACTGG - Intronic
1115319788 14:32067561-32067583 TGATTCTTGGGAAGTGGTACAGG + Intergenic
1118468362 14:66052417-66052439 TATTTCTTAGGAAATGATACGGG - Intergenic
1121983694 14:98478006-98478028 GATTCCTTGGGAATTGGTAGGGG - Intergenic
1129110792 15:73335924-73335946 GCTTTCTTGGGCACTGACACAGG - Intronic
1131971753 15:97900623-97900645 GATTTGTTGGGAAAAGGTAGAGG - Intergenic
1132558412 16:582730-582752 GCCTCCTTGGGAACTGGGACTGG + Intronic
1137517800 16:49163839-49163861 GATTGCCTGGGAACTGGAATGGG - Intergenic
1140355588 16:74303161-74303183 GATTTCTTGGTAACCTTTACAGG - Intronic
1140726985 16:77822489-77822511 GATTTCTTGGATACTGGAAGGGG - Intronic
1143432091 17:6894818-6894840 GGTTTCTTGGGATCTGGTAGGGG - Intronic
1148025446 17:44584478-44584500 CCGTTCTTGGGAACTGGAACCGG - Intergenic
1152188319 17:78872642-78872664 CATTTCCTGGGCACTGGCACTGG + Intronic
1157894379 18:51450114-51450136 GATTTCTCTAGAACTGGTACTGG - Intergenic
1159169727 18:64750381-64750403 GAGTTCTTGGGAAGTGGAAGTGG - Intergenic
1160883144 19:1331643-1331665 GATTTGGGGGGAACTGGAACCGG - Intergenic
1164561997 19:29299055-29299077 GATGTCTCGGGAACTGCTACAGG - Intergenic
1166120312 19:40682542-40682564 GATTATTTGGGAACTGGCATAGG - Intronic
1167210602 19:48131824-48131846 GATTTCTTGACAACTGTTCCTGG - Intronic
925536027 2:4917615-4917637 CATTTCTTGGGATCTGGGATTGG - Intergenic
925838513 2:7968723-7968745 GCTTACTTGGGAAGTGGTGCTGG - Intergenic
925869322 2:8255338-8255360 GATTTCTTGGGAAAATGAACAGG - Intergenic
926450137 2:12993438-12993460 AATTTCTTGGGAGCTGGTTTGGG - Intergenic
927115462 2:19897126-19897148 CATTTTTTGGGTTCTGGTACAGG - Exonic
928110382 2:28503645-28503667 GATGTCTGGGGACTTGGTACTGG + Intronic
928240748 2:29583596-29583618 GATCTCATGGTAACTGGAACAGG - Intronic
928381965 2:30825674-30825696 GATTTCTTGGTCAATGGCACTGG - Intergenic
931809616 2:65842007-65842029 TTTTTCTTGGAAACTGGTAAGGG + Intergenic
932244202 2:70182666-70182688 GATGCCTTGGCAGCTGGTACAGG - Exonic
933029724 2:77313216-77313238 GTTTTCCTGGGACCTGGTGCTGG + Intronic
936670276 2:114648479-114648501 AATTTAGTGGGAACTGGTACTGG - Intronic
938770843 2:134499491-134499513 GCTCTCTGGGGAACTGGAACAGG - Intronic
940622922 2:156135605-156135627 GCTTTCTAGGGAGCTGATACTGG + Intergenic
941647162 2:168052977-168052999 GATTACTTAGGAGCTGGTTCTGG - Intronic
943275909 2:185866484-185866506 GATTTTGTGGCAGCTGGTACCGG - Intergenic
945661367 2:212689099-212689121 AAGTTCTTGGGACCAGGTACAGG + Intergenic
945742594 2:213681486-213681508 GATCTCTTTGGAATTGGAACTGG - Intronic
1170915580 20:20621272-20621294 GATTTGTTGGGAAAAGGTCCAGG - Intronic
1171967031 20:31538295-31538317 GCTTTCTCGGGAACCAGTACAGG + Intronic
1173147678 20:40538902-40538924 CAGTTCTTGGGAACTGGCAAGGG + Intergenic
1175207540 20:57322849-57322871 GACTTCTTGGCAACTGGTTTTGG - Intergenic
1176008788 20:62880840-62880862 GATTTCTTGGGTCCTCATACTGG + Exonic
1183042693 22:35194097-35194119 GACTTCCCGGGAACTGGAACTGG - Intergenic
1185026822 22:48419009-48419031 GATTCCTCGGGGCCTGGTACAGG - Intergenic
951688530 3:25371403-25371425 AATTTCTTGGGAGATGGTGCTGG + Intronic
952817524 3:37458541-37458563 GCTTTCTTGGGATCTGCTGCAGG - Intronic
953748516 3:45593276-45593298 GATCGCCTGGGAACTGGTATAGG + Intronic
954462706 3:50636839-50636861 GATTTCTTGGCAGCTGGACCTGG + Intronic
956352916 3:68357813-68357835 AATTCCTTGGGAACTTGAACAGG - Intronic
956429945 3:69176470-69176492 GAATTCTTTTGAACTGGAACAGG + Intronic
962286308 3:134087961-134087983 GAGTTGTTGGGAACAGGTAAGGG - Intronic
963826082 3:149955468-149955490 GATTTCTTGGGAACTGGTACAGG + Intronic
967702291 3:192607223-192607245 GATTTCATGGGAACTGCTGCAGG - Intronic
968321187 3:197770204-197770226 GGTCTCTTGAGAACTGCTACTGG - Exonic
969879266 4:10159446-10159468 GATTACTTGGGATTTGGTAATGG + Intergenic
971030395 4:22630714-22630736 GATTTATTGGGAAGTGGGAAGGG - Intergenic
972198934 4:36689291-36689313 GTTTCCTTGGGAACTGGAAGAGG - Intergenic
972607931 4:40630717-40630739 GGTTTCTTGGGAATTGGGATGGG - Intronic
977905242 4:102469783-102469805 GATTTGTTGGCAACTTGTGCAGG - Intergenic
979519397 4:121649357-121649379 TACTTCATGGGAACTGGGACTGG + Intergenic
982923333 4:161304173-161304195 AACTTATTGGGAACTGGAACAGG + Intergenic
983415407 4:167446341-167446363 GAGTTCTTGTAAACTGCTACAGG + Intergenic
985375347 4:189331406-189331428 TTTTCCTTGAGAACTGGTACAGG + Intergenic
987718824 5:21609015-21609037 GATTTCTTGAGAATTGGAATAGG - Intergenic
991020040 5:61971069-61971091 TATTTCTTGGCAAATAGTACAGG - Intergenic
994252933 5:97558011-97558033 GAATTCTTGGGTTCTGGTTCTGG - Intergenic
1000376343 5:160585768-160585790 GACTTTCTGGGAACTGGGACAGG - Intronic
1000912359 5:167037746-167037768 CATTTCTTGGAAAGAGGTACAGG + Intergenic
1008176859 6:48278730-48278752 GATTTCTTTGGAATTCATACAGG - Intergenic
1011183745 6:84651274-84651296 GTTTCCTTGAGAACTGGGACTGG + Intergenic
1012202977 6:96428953-96428975 AAGTTCTTGGGTACAGGTACAGG + Intergenic
1013551811 6:111215388-111215410 AATTTGTTGGCAAGTGGTACTGG + Intronic
1014212107 6:118718443-118718465 GATGTCTGGGGAACTGAAACGGG - Intergenic
1018589755 6:165406698-165406720 TATTTCTGGGAGACTGGTACTGG + Intronic
1020135669 7:5586626-5586648 GGTGTCTTGGGCACTGGTGCCGG + Intergenic
1021412125 7:20340725-20340747 TATTTCTTAGTAACTGTTACAGG + Intronic
1024575229 7:50757856-50757878 GATGCCTTGGGAAGTGGTCCTGG - Intronic
1024668689 7:51570465-51570487 GATTTCATGGGAAGTGGAAGAGG + Intergenic
1026156182 7:67827722-67827744 GATCTGTTGGGAACTGGTAGTGG + Intergenic
1028247909 7:88504244-88504266 GATTTCTTGAGTACTTGCACAGG - Intergenic
1030969201 7:116033569-116033591 GAGTATTTGGGTACTGGTACAGG - Intronic
1032821635 7:135529414-135529436 GATTTCTTGGGATCTTCTACAGG - Intergenic
1033165257 7:139034651-139034673 GATATCATGGGAAAGGGTACAGG + Exonic
1034119462 7:148614090-148614112 GATTTGGTGGGAGCTGATACAGG - Exonic
1037038906 8:14205349-14205371 GATTGCTTGGAAAATGGTCCAGG - Intronic
1038291653 8:26255028-26255050 AATTTCTTGGTAAATAGTACAGG + Intergenic
1041785452 8:61627958-61627980 GATTTCATGGAAACTGGAGCTGG - Intronic
1044586495 8:93873636-93873658 GCTTTCTTGGGATCTGGATCAGG - Intronic
1046378979 8:113428678-113428700 TATGTTTTGGGAAATGGTACCGG - Intronic
1046841382 8:118861559-118861581 CAATTCTTGGCAACTGGGACTGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1056109625 9:83381981-83382003 GATTTCTTGGGAGTAGGGACTGG - Intronic
1057021909 9:91706097-91706119 CATTTCTTGGGGTCTGCTACTGG + Intronic
1058953775 9:109927071-109927093 CATTTCTTGGGAAGTGGCCCAGG + Intronic
1059250966 9:112887697-112887719 GATTACTAGGGAAGTGGAACTGG + Intronic
1190128915 X:47729132-47729154 GGTTTCTTGGGATGGGGTACAGG + Intergenic
1191954926 X:66633946-66633968 GATTGCTTGGTAAATGGGACAGG - Intronic
1193490246 X:82140921-82140943 GATTTCTTGGGAAGAGATAGAGG - Intergenic
1196126710 X:112109141-112109163 GATTTCTTTAGCACTGGTAAAGG + Intergenic
1196142776 X:112283382-112283404 GATCTCTCTGGCACTGGTACTGG - Intergenic
1198122569 X:133608371-133608393 GATTTCTTTGGAAATGGAGCAGG - Intronic
1201342045 Y:12944775-12944797 CATTTATTAGGAACTGGTAAGGG + Intergenic