ID: 963827265

View in Genome Browser
Species Human (GRCh38)
Location 3:149970108-149970130
Sequence GAGATGTACGCCGACCGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 10}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963827265_963827268 5 Left 963827265 3:149970108-149970130 CCTACGCGGTCGGCGTACATCTC 0: 1
1: 0
2: 0
3: 0
4: 10
Right 963827268 3:149970136-149970158 AGCCCCAGAGGCCTGGACATCGG 0: 1
1: 0
2: 2
3: 29
4: 257
963827265_963827267 -2 Left 963827265 3:149970108-149970130 CCTACGCGGTCGGCGTACATCTC 0: 1
1: 0
2: 0
3: 0
4: 10
Right 963827267 3:149970129-149970151 TCTCGCAAGCCCCAGAGGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 154
963827265_963827266 -7 Left 963827265 3:149970108-149970130 CCTACGCGGTCGGCGTACATCTC 0: 1
1: 0
2: 0
3: 0
4: 10
Right 963827266 3:149970124-149970146 ACATCTCTCGCAAGCCCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963827265 Original CRISPR GAGATGTACGCCGACCGCGT AGG (reversed) Intronic
917525242 1:175782677-175782699 GAGATGGAAGCTGACCGCCTTGG + Intergenic
1092764657 12:11841793-11841815 GAGATGTAGGCCGGGCGCGGTGG + Intronic
1117771796 14:59141009-59141031 GAAATGTAGGCCGAGCGCGGTGG + Intergenic
1126645932 15:50874817-50874839 GAGCTGTACCCCGACCACCTGGG - Intergenic
1133741110 16:8652169-8652191 GAGATGTAGGCCGGGCGCGGTGG + Intergenic
1152188803 17:78875735-78875757 GAGATTTGAGCCGACCACGTGGG - Intronic
1168498223 19:56871970-56871992 AAGCTGTACCCCGACCGCCTGGG + Intergenic
1168877414 20:1181110-1181132 GAGATGTACTACGCCCGCCTAGG - Exonic
963827265 3:149970108-149970130 GAGATGTACGCCGACCGCGTAGG - Intronic
976584959 4:86786813-86786835 GTGATGTAGGCCGGGCGCGTTGG + Intronic
1195292013 X:103438540-103438562 GAGCTGTACCCCGACCACTTTGG + Intergenic