ID: 963827361

View in Genome Browser
Species Human (GRCh38)
Location 3:149970439-149970461
Sequence GGTCCAGGTGCCCGGGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 254}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963827361_963827370 -6 Left 963827361 3:149970439-149970461 CCCCCAACCCGGGCACCTGGACC 0: 1
1: 0
2: 2
3: 25
4: 254
Right 963827370 3:149970456-149970478 TGGACCGACGCTGGGAACGCCGG 0: 1
1: 0
2: 0
3: 2
4: 55
963827361_963827376 9 Left 963827361 3:149970439-149970461 CCCCCAACCCGGGCACCTGGACC 0: 1
1: 0
2: 2
3: 25
4: 254
Right 963827376 3:149970471-149970493 AACGCCGGGGGCGCCCGGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 130
963827361_963827379 19 Left 963827361 3:149970439-149970461 CCCCCAACCCGGGCACCTGGACC 0: 1
1: 0
2: 2
3: 25
4: 254
Right 963827379 3:149970481-149970503 GCGCCCGGCCAGGGCCAGCAAGG 0: 1
1: 0
2: 3
3: 28
4: 297
963827361_963827372 -4 Left 963827361 3:149970439-149970461 CCCCCAACCCGGGCACCTGGACC 0: 1
1: 0
2: 2
3: 25
4: 254
Right 963827372 3:149970458-149970480 GACCGACGCTGGGAACGCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 34
963827361_963827382 26 Left 963827361 3:149970439-149970461 CCCCCAACCCGGGCACCTGGACC 0: 1
1: 0
2: 2
3: 25
4: 254
Right 963827382 3:149970488-149970510 GCCAGGGCCAGCAAGGAGTCCGG 0: 1
1: 0
2: 5
3: 47
4: 348
963827361_963827373 -3 Left 963827361 3:149970439-149970461 CCCCCAACCCGGGCACCTGGACC 0: 1
1: 0
2: 2
3: 25
4: 254
Right 963827373 3:149970459-149970481 ACCGACGCTGGGAACGCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 28
963827361_963827371 -5 Left 963827361 3:149970439-149970461 CCCCCAACCCGGGCACCTGGACC 0: 1
1: 0
2: 2
3: 25
4: 254
Right 963827371 3:149970457-149970479 GGACCGACGCTGGGAACGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 75
963827361_963827377 10 Left 963827361 3:149970439-149970461 CCCCCAACCCGGGCACCTGGACC 0: 1
1: 0
2: 2
3: 25
4: 254
Right 963827377 3:149970472-149970494 ACGCCGGGGGCGCCCGGCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 110
963827361_963827375 4 Left 963827361 3:149970439-149970461 CCCCCAACCCGGGCACCTGGACC 0: 1
1: 0
2: 2
3: 25
4: 254
Right 963827375 3:149970466-149970488 CTGGGAACGCCGGGGGCGCCCGG 0: 1
1: 0
2: 2
3: 22
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963827361 Original CRISPR GGTCCAGGTGCCCGGGTTGG GGG (reversed) Intronic