ID: 963829613

View in Genome Browser
Species Human (GRCh38)
Location 3:149992844-149992866
Sequence CTATGGATATGGAGATGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963829613_963829620 9 Left 963829613 3:149992844-149992866 CCCTTTCATCTCCATATCCATAG 0: 1
1: 0
2: 3
3: 22
4: 286
Right 963829620 3:149992876-149992898 GACATACCTTGCATGCAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963829613 Original CRISPR CTATGGATATGGAGATGAAA GGG (reversed) Intronic
901261380 1:7874418-7874440 CCATGGATGTGGAGATGCAGGGG - Intergenic
901412066 1:9091285-9091307 CTATGTAAATATAGATGAAAAGG - Intergenic
902638196 1:17748882-17748904 TGATGGAGATGAAGATGAAATGG - Intergenic
902638204 1:17748977-17748999 TGATGGAGATGAAGATGAAATGG - Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
905682579 1:39884673-39884695 CTTTGGCCAAGGAGATGAAAAGG - Intergenic
905969881 1:42133689-42133711 TTGTGCATATGGAGAGGAAAGGG + Intergenic
907183709 1:52592472-52592494 GTAGGGATAGGGAGAGGAAAGGG - Intergenic
907812312 1:57883521-57883543 CAATAGATATGAAGATTAAAGGG - Intronic
908477432 1:64504003-64504025 CAATGGAGATGCACATGAAAAGG + Intronic
909157401 1:72095624-72095646 ATATGTATATGTAGATGACATGG - Intronic
909893956 1:81042473-81042495 CTGTGGTTATAAAGATGAAAAGG + Intergenic
910504993 1:87940275-87940297 CGGTGGAGATGGTGATGAAATGG + Intergenic
912653980 1:111469094-111469116 CTAAGGAAATTGAGAAGAAATGG - Intergenic
913245828 1:116869250-116869272 CTATGGATTTGGAGGGGGAAAGG + Intergenic
914719230 1:150275673-150275695 CTCTAGATCTGGAAATGAAAAGG - Intronic
915398553 1:155605387-155605409 CTCTGAATTTGTAGATGAAATGG + Intergenic
916301003 1:163274463-163274485 AAATGGATAAGCAGATGAAAAGG - Intronic
917367375 1:174247430-174247452 TTAGGCATATAGAGATGAAAAGG + Intronic
918665389 1:187144672-187144694 ATAGGGATATGGAGATAATAGGG + Intergenic
919100610 1:193092991-193093013 GTATGGAAAGGGAGAAGAAATGG + Intergenic
919500661 1:198334243-198334265 TTCTGGCTATGAAGATGAAAGGG + Intergenic
920047704 1:203144301-203144323 CTGTGGATATAGAGATGAATAGG - Intronic
920433408 1:205933209-205933231 CCAGGGATATTGAGAAGAAAAGG + Intronic
923846671 1:237741308-237741330 CTCTGGGCATGGAGATGAACTGG - Intronic
1065206681 10:23363725-23363747 TTATGGATATGAAGTTGAAGGGG - Intergenic
1065872801 10:29970421-29970443 CTATAGTTGTGGAGATCAAATGG + Intergenic
1067112785 10:43412226-43412248 CTATGGACACAGAGGTGAAAGGG - Intergenic
1067496804 10:46768077-46768099 CTATAGAGTAGGAGATGAAAGGG + Intergenic
1067597849 10:47572326-47572348 CTATAGAGTAGGAGATGAAAGGG - Intergenic
1068483967 10:57632437-57632459 CTAAGCAGATGGAGAGGAAAGGG - Intergenic
1068648116 10:59492385-59492407 CCAGGGATGTGGAGATGCAAGGG - Intergenic
1069172294 10:65247426-65247448 ATGTGGAGATGAAGATGAAAGGG - Intergenic
1069315480 10:67094846-67094868 CTATGGATATATACATGATATGG - Intronic
1070663752 10:78328848-78328870 CCAGGGATATGGAGATGCAGGGG + Intergenic
1071615490 10:87071571-87071593 CTATAGAGTAGGAGATGAAAGGG + Intronic
1073636154 10:105200847-105200869 CTATGGAGGTGGAGCAGAAACGG + Intronic
1075918034 10:126186555-126186577 CTAGGGACATGGGGATGAATGGG + Intronic
1076418663 10:130311772-130311794 AAATGGATATGGAAATGCAAAGG + Intergenic
1078282309 11:9915072-9915094 TTGTGAAGATGGAGATGAAATGG + Intronic
1078445160 11:11398695-11398717 GTTTTGATATGGAGAAGAAAAGG + Intronic
1078841906 11:15085105-15085127 CTAAGCATATGAAGATGCAAAGG + Intergenic
1079863623 11:25706907-25706929 TGATGGATGTGGAGATGGAAAGG + Intergenic
1080974057 11:37314105-37314127 CTATAAATTTGGAGATGATAAGG - Intergenic
1081041395 11:38218698-38218720 ATATGGATATTGACATTAAATGG + Intergenic
1082853739 11:57788188-57788210 CTTAAGAAATGGAGATGAAAGGG + Intronic
1083038128 11:59659368-59659390 CAATGGAGAGAGAGATGAAATGG - Exonic
1083786270 11:64949765-64949787 CTCTATATGTGGAGATGAAATGG - Exonic
1085234087 11:74998602-74998624 CTGTGGATATGAAGATTTAATGG - Intronic
1085690748 11:78661918-78661940 CTATGGATGTTGGGGTGAAAGGG - Intronic
1086030445 11:82348918-82348940 CTATGGATATAGAAATCAAATGG - Intergenic
1086649153 11:89265720-89265742 CTATGGAAAGGGAGATAACATGG - Intronic
1088774547 11:113069688-113069710 CAATGGCTATGGAGATGGAGAGG + Intronic
1088818913 11:113440595-113440617 CATTAGATATGAAGATGAAAGGG + Intronic
1088846274 11:113670927-113670949 ATATGGAGATGCAGATGAACTGG - Intergenic
1089085766 11:115815619-115815641 CTCAGAATATGAAGATGAAATGG - Intergenic
1090059157 11:123448815-123448837 CTATGGTGATGGAGCTGAGAAGG - Intergenic
1090795327 11:130130886-130130908 CTATGAGTGTGAAGATGAAAAGG + Intronic
1091082552 11:132685162-132685184 CTATTGGCATGGAGATGACAGGG - Intronic
1093347345 12:18054919-18054941 CACTGGATGTGGAGAGGAAATGG - Intergenic
1093765409 12:22956175-22956197 CTCTGGAAATGCAGATCAAAAGG - Intergenic
1094068918 12:26391442-26391464 ATTTGGAGATGCAGATGAAATGG + Intronic
1095124817 12:38464443-38464465 CTATGGCTACTGAGAGGAAAGGG + Intergenic
1095225519 12:39672796-39672818 CCAGGGATATGTAGATGCAAGGG + Intronic
1095494747 12:42772565-42772587 CTAAGGATATCGAGATGCAGGGG - Intergenic
1096716345 12:53493607-53493629 CTGAGAAAATGGAGATGAAAGGG + Intronic
1097020258 12:56015742-56015764 CTAATGATTTGGAAATGAAAGGG + Intronic
1097516073 12:60608074-60608096 CCAAGGATATGGAGATGAAGAGG + Intergenic
1100082347 12:90868027-90868049 CTAAAAATATGGAGATGGAATGG - Intergenic
1100122798 12:91388440-91388462 ATATGGAATTGGAGATGAACTGG + Intergenic
1101479392 12:105083016-105083038 CTATGGATGTGGGGAAGAACTGG - Intronic
1101809213 12:108093171-108093193 CTGGGGACATAGAGATGAAAAGG - Intergenic
1102456418 12:113073550-113073572 CTATGGCTATTGATATGAAAGGG - Intronic
1102836863 12:116071874-116071896 ATAGGGATATGGAGCAGAAAGGG - Intronic
1103077014 12:117991861-117991883 TTATGGAAATGAAGATGAATAGG - Intergenic
1104226642 12:126841259-126841281 CTATTTATATGGGGATAAAACGG + Intergenic
1105612902 13:21984959-21984981 TAAAGGATATGGTGATGAAAAGG + Intergenic
1108347137 13:49557353-49557375 CAAAGGAAATGGAGAGGAAATGG + Intronic
1108909951 13:55536041-55536063 CTATGGGTATACAGATAAAATGG + Intergenic
1109524255 13:63555292-63555314 TAATGCATATGGAAATGAAAAGG - Intergenic
1110134380 13:72047410-72047432 CTAGAGATATGGAGAAGATATGG + Intergenic
1111533710 13:89574262-89574284 CTATGGATATGAATAAGACAAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111685511 13:91496588-91496610 TTATGGACATAGAGATAAAAAGG + Intronic
1112136595 13:96585067-96585089 CTTTGAATATGGAGCTTAAATGG + Intronic
1112837260 13:103531281-103531303 CTATAGAAATGGAGATGAAGGGG - Intergenic
1113008249 13:105732895-105732917 CGATTGACATGGAGCTGAAATGG + Intergenic
1113449761 13:110399586-110399608 CTATGCATCTGGAGAATAAAAGG - Intronic
1114137812 14:19872745-19872767 CTAAGGAGAGGGAGATGATAGGG + Intergenic
1114669291 14:24400192-24400214 CTATGGGTTTTCAGATGAAAGGG + Intronic
1116348151 14:43822828-43822850 CCATGGGGATGGAGATGAGATGG + Intergenic
1117783792 14:59261350-59261372 CTAAGCATATGGAAATGAACAGG - Intronic
1118130900 14:62962132-62962154 AGATGGAGATGGAGATGAGAAGG + Intronic
1118322680 14:64762583-64762605 CTATGGGAATGGAGACGCAAGGG + Intronic
1119330708 14:73791313-73791335 CTAGGGATGCAGAGATGAAAAGG + Intergenic
1120487512 14:85132503-85132525 TTATGCAAATGGAGATCAAAAGG + Intergenic
1121026603 14:90620866-90620888 CTCAGGATATGGAATTGAAAAGG + Intronic
1121038326 14:90725024-90725046 CAAGAGATACGGAGATGAAAAGG - Intronic
1122285914 14:100652562-100652584 CGATGGATCTCGAGATGAATGGG + Intergenic
1126076042 15:44910859-44910881 CAATGGATATACAGAAGAAATGG - Intergenic
1126261750 15:46701384-46701406 AGATGGATATGGCCATGAAAGGG - Intergenic
1126748808 15:51854471-51854493 CTATGGAAATGGTGGTGAAATGG + Intronic
1126825804 15:52546542-52546564 CTAGAGATGTGGAGATGCAAGGG + Intergenic
1127521025 15:59743082-59743104 ATATTGATATAGAGAGGAAAAGG - Intergenic
1128195561 15:65751588-65751610 GTAGGGATGGGGAGATGAAAAGG + Intronic
1128881151 15:71244111-71244133 TCATGGTTAAGGAGATGAAATGG - Intronic
1130409531 15:83633111-83633133 CAATGTAAATGGATATGAAAAGG + Intergenic
1133505845 16:6411282-6411304 CTATGGTTATCTAGATAAAAAGG - Intronic
1134025843 16:10953040-10953062 GAATGTATATGGAGATTAAAAGG + Intronic
1134502362 16:14779269-14779291 CTATGGAAATGGATGAGAAAAGG + Intronic
1134578200 16:15349625-15349647 CTATGGAAATGGATGAGAAAAGG - Intergenic
1134724391 16:16407921-16407943 CTATGGAAATGGATGAGAAAAGG + Intergenic
1134943040 16:18303938-18303960 CTATGGAAATGGATGAGAAAAGG - Intergenic
1135580320 16:23620223-23620245 CTATGAATATGCAGTTTAAAGGG + Intronic
1136181124 16:28553193-28553215 CTAAGGATATGGACGTGCAATGG - Intergenic
1136517872 16:30778711-30778733 CTATGGACATGGAGGTCAGATGG - Exonic
1137817332 16:51411010-51411032 CTAGGGAGATTGAGGTGAAAGGG + Intergenic
1138712551 16:58986159-58986181 CCAGGGATGTGGAGATGAATGGG - Intergenic
1140104162 16:71944013-71944035 TTTTGGGTATGGAGAGGAAATGG - Exonic
1140171515 16:72609778-72609800 CTATGAAGTTGGAGATCAAAAGG + Intergenic
1144862945 17:18317159-18317181 ACCTGGATATGGATATGAAAGGG + Exonic
1146985208 17:37209590-37209612 ATTTGGATGTGGAGAGGAAAGGG - Intronic
1148076324 17:44937707-44937729 GTATGAATATGGAGAAGAAAAGG - Intronic
1149225846 17:54469737-54469759 CAGTGGATGTGAAGATGAAAAGG - Intergenic
1151033851 17:70774971-70774993 CTAAGGATACAGAGTTGAAAGGG + Intergenic
1151651502 17:75472992-75473014 CTAGGGATATTGAGATGAAGTGG - Intronic
1155375291 18:25150747-25150769 GAATGGAAATGGAGAAGAAATGG - Intronic
1158735548 18:60075265-60075287 CCAGGGATATGGAGATGCAGGGG - Intergenic
1164745868 19:30612459-30612481 CTCTGGATATGGAGATACCATGG + Intronic
1164934966 19:32202967-32202989 CTGGGGAGATGGTGATGAAAAGG - Intergenic
1165613184 19:37174959-37174981 CTATTGTTATGGAAATAAAAGGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
926114982 2:10207265-10207287 CCATGGAGATGGAGAGAAAAGGG - Intronic
926725792 2:15996751-15996773 CTATGCATTAGGACATGAAATGG - Intergenic
926847554 2:17159215-17159237 CAATGGCTATGAACATGAAATGG + Intergenic
928035020 2:27814778-27814800 CTATGGATTTGGAGATCAAAGGG - Intronic
928264220 2:29797730-29797752 GCATGGATATGGAGATGAGTAGG - Intronic
928792422 2:34973670-34973692 CCATGGAAATGGGGAGGAAAGGG + Intergenic
929094554 2:38251106-38251128 ACATGGTTATGGAAATGAAAGGG + Intergenic
929167651 2:38899882-38899904 CAATGGATATGAATATGAAATGG + Intronic
932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG + Intronic
933054366 2:77643229-77643251 CCAGGGATGTGGAGATGTAAGGG + Intergenic
935431438 2:102980263-102980285 ATATGGAGATGCAGATGAAGTGG - Intergenic
935995843 2:108772021-108772043 CAATGGATATAGTGATCAAAAGG + Intronic
938881739 2:135596532-135596554 CTCTGGAGAGGGAAATGAAAGGG - Intronic
939114783 2:138048285-138048307 CTTTGGACATGGAAATCAAAGGG - Intergenic
939357658 2:141125033-141125055 CAAAAGATATGGAAATGAAAAGG + Intronic
939802942 2:146735433-146735455 TTATTGATATGGACATTAAATGG - Intergenic
940907902 2:159185220-159185242 CTATGGACATGGAGGGCAAATGG + Intronic
946932737 2:224687217-224687239 CTATGGATCAGTTGATGAAATGG + Intergenic
1170202402 20:13759699-13759721 ATATGGAAATGGAAATTAAATGG - Exonic
1170309684 20:14978677-14978699 CTTGGGTTTTGGAGATGAAATGG - Intronic
1170615517 20:17946165-17946187 CTATGGATGTGGACATGGACCGG + Intronic
1172430394 20:34885918-34885940 TTATGGATATGGGGGTAAAAAGG + Intronic
1175675202 20:60940623-60940645 ATATGGGTATGGATATGATATGG + Intergenic
1175689475 20:61055159-61055181 CTTTGGAGATGCAGAAGAAAAGG + Intergenic
1177922205 21:27166034-27166056 CTAAGAATATGGAAATGAATAGG + Intergenic
1178742277 21:35212949-35212971 CTGTGGATTTGGAGATTAATTGG + Intronic
1179059837 21:37969663-37969685 TTATGGATATTGAAATCAAATGG - Intronic
950830902 3:15875158-15875180 AAATGGATATGTAGATAAAATGG + Intergenic
951011592 3:17688190-17688212 ATATGTATATTGATATGAAATGG - Intronic
951525408 3:23648308-23648330 CTATGTATTTGGAGAGGAAATGG + Intergenic
951721115 3:25699251-25699273 CCATGGTTATGAAGATTAAAGGG + Intergenic
951924548 3:27893777-27893799 ATATGGAAAAGGAGATGAGAAGG + Intergenic
952997056 3:38894701-38894723 CCCTGGTCATGGAGATGAAAAGG - Exonic
954677914 3:52325783-52325805 CACTGGATAGGAAGATGAAATGG - Intronic
955175967 3:56613048-56613070 CTAGGGATGTGGAGATGCAGGGG + Intronic
956007924 3:64800244-64800266 GTATGGAAACAGAGATGAAAGGG - Intergenic
956887103 3:73571254-73571276 CACTGGATATGGAGAAAAAAGGG - Intronic
958960866 3:100508357-100508379 CCAGGGATATGGAGATGCATGGG - Intronic
961266618 3:125648046-125648068 CTACGGAAATGGATAGGAAAGGG + Intergenic
962009610 3:131381109-131381131 CTAGGGAAATGGAGATGGACAGG - Intergenic
962658136 3:137570537-137570559 CTATGGGTATGGAGAGTAAGGGG - Intergenic
962927318 3:140007139-140007161 CTAGGGATATGAAAATGAGATGG + Intronic
962962182 3:140321238-140321260 CTATGGATATGGAGAGTCCAGGG - Intronic
963097322 3:141557748-141557770 CTATGGAAATAGAGAGGAAGAGG + Intronic
963499012 3:146101258-146101280 CAATGTATATGGAAAAGAAAAGG + Intronic
963510752 3:146245174-146245196 CTATGGATAAGGAAAGAAAATGG + Intronic
963758247 3:149258763-149258785 CTAGGGATGTGGAGATACAAGGG - Intergenic
963829613 3:149992844-149992866 CTATGGATATGGAGATGAAAGGG - Intronic
964650411 3:159005167-159005189 CTTAGGAAATGGAGATGAAGAGG + Intronic
965231087 3:166053767-166053789 CTATGAATATGTAGGTGCAAGGG - Intergenic
966001979 3:174960593-174960615 CTATCGATATCTAGATGAAGGGG - Intronic
967460093 3:189735605-189735627 CAATGGGAATGGAGATGATAGGG - Intronic
967592251 3:191292074-191292096 CAATGTATATGGAAATGCAAGGG - Intronic
969313828 4:6369871-6369893 CTAGGGACATGGGGATGAATGGG - Intronic
969331399 4:6475171-6475193 GAATGGAGATGGAGATGAACGGG + Intronic
970208377 4:13679933-13679955 CTCTGGATATGGAGATGGAAAGG + Intergenic
970847888 4:20564270-20564292 ATATGGACAGGGAGATGAATGGG + Intronic
970934315 4:21550615-21550637 CTATGGGTAGGGAGGTTAAATGG - Intronic
971258875 4:25038240-25038262 ATATGGATATGGATAAGATATGG + Intergenic
972928067 4:44037198-44037220 CTATGGATCTGGAGATAATGGGG - Intergenic
977583173 4:98746914-98746936 CAGTGGATAGGGAGGTGAAAAGG - Intergenic
978272851 4:106912470-106912492 GTATGAATTTGGAGAAGAAAAGG + Intergenic
978519642 4:109603088-109603110 CTATGGAGAGGGAGATGGAGAGG - Intronic
979285715 4:118922051-118922073 CTAAGGATATAAAGATGAACAGG - Intronic
979388765 4:120101488-120101510 CTAGAAATATGGACATGAAAAGG - Intergenic
979764549 4:124448160-124448182 CCAGGGATATGGAGAGGAAGGGG + Intergenic
979774307 4:124569189-124569211 GTATGGATGTTGAGATTAAAGGG + Intergenic
980006151 4:127544568-127544590 GTATGGATGTGGAGCTGGAAAGG - Intergenic
980131602 4:128821464-128821486 TAATGGATAAGGAGTTGAAATGG + Intronic
980704787 4:136479279-136479301 CTTTGGATATGTACATCAAAGGG - Intergenic
984841657 4:184073720-184073742 TTAAGGATATGGAAAAGAAATGG - Intergenic
986750120 5:10779677-10779699 CCATGGATGTGGAGATGCAGGGG - Intergenic
986890516 5:12299366-12299388 CTAGGGATGTGGAGATGCAGGGG - Intergenic
987588143 5:19885997-19886019 CTATGGTCATGGAAATAAAATGG - Intronic
988393358 5:30664694-30664716 TTAAGGATCTTGAGATGAAAAGG + Intergenic
989386775 5:40862371-40862393 CTATGTATTTGGGGAGGAAAAGG - Intergenic
989658533 5:43772427-43772449 CTAAGGCGATGGAGATAAAAGGG - Intergenic
989774865 5:45193008-45193030 CTATGGAAGTGGAGATGAAAGGG - Intergenic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
990184580 5:53199897-53199919 CTATGCCTATGGAGATAAACTGG - Intergenic
991230325 5:64325218-64325240 CAATGAATATGCAGAAGAAAAGG + Exonic
991610451 5:68444452-68444474 CTTTAGGTATGTAGATGAAAAGG - Intergenic
992000888 5:72435263-72435285 CAAGGTCTATGGAGATGAAAAGG + Intergenic
993335046 5:86646591-86646613 GTATGGACATGGAAGTGAAAAGG + Intergenic
993342222 5:86738721-86738743 CTAGGGACATGGAGATGCAAAGG + Intergenic
993441808 5:87966003-87966025 CTATGAATATGGGAATGGAATGG - Intergenic
993912572 5:93702545-93702567 CTAGGGATTTGGCTATGAAAAGG - Intronic
995391385 5:111643964-111643986 CTATGGCTTTAGAGATAAAATGG - Intergenic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
1000765712 5:165286549-165286571 CCAGGGATGTGGAGATGTAAGGG - Intergenic
1001071221 5:168586964-168586986 TTAGGGATATGGAGATGAATGGG + Intergenic
1002436445 5:179234673-179234695 CCTTGGATGTGGAGATGAGATGG - Intronic
1003061203 6:2864078-2864100 CTGGGGATATAAAGATGAAAAGG - Intergenic
1004741057 6:18461601-18461623 CTCTGGTTCTGGAGATGAAATGG + Intronic
1008636968 6:53420302-53420324 CCATGGTTATGAAGATTAAAGGG - Intergenic
1009741608 6:67754247-67754269 CCAAGCAAATGGAGATGAAAAGG + Intergenic
1009957270 6:70471012-70471034 CTAAGAATATGGGGATAAAATGG + Intronic
1010124201 6:72413293-72413315 GTAAGGATATTGAGATGAGAAGG - Intergenic
1011262463 6:85483672-85483694 CTGTGGTTATTGAGCTGAAAGGG + Intronic
1011551541 6:88535245-88535267 CTATGAATATGGATAGGCAATGG + Intergenic
1012746722 6:103100465-103100487 TTTTGGATATGGTGAAGAAAGGG - Intergenic
1013158379 6:107517021-107517043 AAATGTATATGGAGATGCAAAGG + Intronic
1013373568 6:109491813-109491835 CTATGGAGAGAGAGGTGAAAAGG + Intergenic
1013985491 6:116187368-116187390 CAATTTATATGGAAATGAAAAGG + Intronic
1014203686 6:118631755-118631777 CTATAGAAATGGAGAGTAAATGG + Intronic
1014532643 6:122577522-122577544 TCATGGATATTGAGAAGAAATGG - Intronic
1015206239 6:130642737-130642759 GTATGGCTATGGAGATGATATGG - Intergenic
1015630803 6:135230157-135230179 CCATGGAAATGAAGATTAAAGGG - Intergenic
1016384232 6:143515351-143515373 CTCTGGACATGCAGAAGAAAAGG + Intergenic
1018276326 6:162135670-162135692 CTGTGGATCTGCAGATGAGAGGG + Intronic
1018371634 6:163173843-163173865 CTTTGGCTATGGAGAGGACAAGG - Intronic
1018459651 6:163985798-163985820 ATATGTTTATGGAGAGGAAATGG + Intergenic
1019613080 7:1946748-1946770 CTAGGGTTCTGGAGATGACAGGG + Intronic
1019941308 7:4293848-4293870 CTATGGAGACAGAAATGAAAAGG + Intergenic
1020824735 7:13012634-13012656 CAATGGATATGGTGAAGAACAGG - Intergenic
1020875820 7:13692211-13692233 CTGTAGAAATAGAGATGAAAAGG + Intergenic
1020948264 7:14643472-14643494 CTATGGATGTGGAGATACAGGGG - Intronic
1020972381 7:14961492-14961514 CCATGCCTATGGAGATGCAAGGG + Intronic
1021006709 7:15405049-15405071 CTATGAAAATGGAAATGACAGGG - Intronic
1021013883 7:15507888-15507910 GTGTGGATGTGGATATGAAAGGG + Intronic
1021274432 7:18632055-18632077 ATATGGAAATGGAAATGATATGG + Intronic
1021549751 7:21857960-21857982 CAAAAGATATGAAGATGAAAAGG + Intronic
1022317749 7:29261351-29261373 CAATGGGTTTGGAGATGAAGTGG - Intronic
1022843991 7:34191674-34191696 CTATGGCGACGGAGATGACAGGG + Intergenic
1023610171 7:41964792-41964814 GTATCAAGATGGAGATGAAAGGG - Exonic
1024802430 7:53096160-53096182 ATATGGATATGGAGATGCTTTGG - Intergenic
1026132029 7:67628838-67628860 CTGTGGGTTTGAAGATGAAAAGG + Intergenic
1027663366 7:81014728-81014750 CTATGGATATAGAGTTGGGATGG + Intergenic
1027666704 7:81049110-81049132 CTATGTATATGGTGATTAATAGG + Intergenic
1029868924 7:103667128-103667150 CTATGGATTTGCAGAGGAAAAGG + Intronic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1031350979 7:120730799-120730821 ATATGGAGATGGAGAGGAATTGG - Intronic
1034320430 7:150175009-150175031 ATATGGAAATGGAAATGAAGAGG + Intergenic
1034772314 7:153792216-153792238 ATATGGAAATGGAAATGAAGAGG - Intergenic
1035058500 7:156052217-156052239 GGATGGATGGGGAGATGAAAGGG - Intergenic
1035772645 8:2160973-2160995 CTAAGCATCTAGAGATGAAAAGG + Intronic
1037423483 8:18728837-18728859 CTATGAAAATGAATATGAAAGGG + Intronic
1037770886 8:21798966-21798988 CTAAGGCTATGGTGATGAAGAGG - Intronic
1037772797 8:21812297-21812319 CCATGGATCTGGAGTTGGAACGG - Intronic
1039160174 8:34609867-34609889 TTTTTGATATGGAGATGCAAAGG + Intergenic
1039174723 8:34790769-34790791 CAATGGACATAGTGATGAAAGGG - Intergenic
1039306067 8:36264396-36264418 ATGAGGATATGGAGATGACAGGG - Intergenic
1039934506 8:42030059-42030081 CTACGGATATGGAGATTCAAGGG + Intronic
1043027667 8:75091242-75091264 CTATGGAAAAGGAGAAGACAGGG - Intergenic
1043837090 8:85060488-85060510 CCAGGGATATGGAGATGCAAGGG + Intergenic
1044089388 8:87980291-87980313 CCAGGGGTTTGGAGATGAAACGG - Intergenic
1044736174 8:95280911-95280933 GCATGGACATGGAGCTGAAAAGG - Intergenic
1045143818 8:99316326-99316348 ATAGGGATATGGAGATGTAGGGG + Intronic
1045923386 8:107559390-107559412 CTAAGGATATGAAGTTTAAAAGG - Intergenic
1047019633 8:120761148-120761170 CTATTGATATGGCGCTAAAATGG - Intronic
1051207281 9:14701488-14701510 CTCTGGGAAAGGAGATGAAAAGG + Intergenic
1051488227 9:17631769-17631791 CTATGGATTGGGAGATTAAAAGG - Intronic
1051991343 9:23155914-23155936 AGATGGATTTGAAGATGAAAAGG - Intergenic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1054732637 9:68716167-68716189 ATATGGACATGCAGTTGAAAGGG + Intronic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059763353 9:117360502-117360524 CTGGGGATATGGAGATGAGCAGG + Intronic
1059840974 9:118215863-118215885 AAATGTTTATGGAGATGAAAGGG + Intergenic
1061644250 9:131987336-131987358 CTGTAGATGTGGAGATGAGAAGG + Intronic
1187326364 X:18294616-18294638 CTAGGGATGTGGAGATGTAGGGG - Intronic
1187410838 X:19049266-19049288 CTGTGCATAAAGAGATGAAAAGG - Intronic
1188299113 X:28485469-28485491 CTTTGGAAATGGAAATGAAGAGG + Intergenic
1188447004 X:30264969-30264991 CAATGGATATGGGGAAGAAAGGG + Intergenic
1189614080 X:42766477-42766499 CTATGTAAATATAGATGAAAGGG - Intergenic
1190511865 X:51181357-51181379 CTATGGTTATTGAGATCACATGG + Intergenic
1191088945 X:56599361-56599383 ATATTGATAGGGAGATGCAATGG + Intergenic
1192540677 X:71969010-71969032 CAATCCATATGGAAATGAAAGGG - Intergenic
1195121165 X:101754220-101754242 GTATACATATGGACATGAAAAGG - Intergenic
1195159039 X:102154061-102154083 AGATGGAGATGGAGATGATATGG - Exonic
1195390633 X:104358495-104358517 CAATGCATAGGGAGGTGAAATGG - Intergenic
1196575902 X:117318726-117318748 CTGTGGTCATGTAGATGAAATGG - Intergenic
1196742138 X:119034321-119034343 CAATGGACAGGGAGAGGAAATGG - Intergenic
1197027002 X:121764133-121764155 ATAGGGAGATGCAGATGAAAGGG + Intergenic
1197701431 X:129603024-129603046 CAATGGAGATGGAGATGGAGTGG - Intergenic
1198185434 X:134249806-134249828 CTGGGGATATGGAAATCAAAGGG + Intergenic
1199105523 X:143861874-143861896 AAATTTATATGGAGATGAAAAGG - Intergenic
1199208515 X:145177972-145177994 CTATTGATGTGGAGAAGAAGTGG - Intergenic
1199252473 X:145679161-145679183 CACTGGATATGGAGATGAGAAGG - Intergenic
1200293908 X:154898259-154898281 CCATGGAGATGGAGTTGAAAGGG - Intronic