ID: 963831228

View in Genome Browser
Species Human (GRCh38)
Location 3:150011801-150011823
Sequence AAGAAGAAGAAGAAGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963831226_963831228 18 Left 963831226 3:150011760-150011782 CCTAAAATAAAAGTTAAAAGTTT 0: 2
1: 13
2: 135
3: 623
4: 2787
Right 963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG 0: 13
1: 55
2: 313
3: 900
4: 3924
963831225_963831228 26 Left 963831225 3:150011752-150011774 CCTCTGAACCTAAAATAAAAGTT 0: 686
1: 2495
2: 3535
3: 3156
4: 2767
Right 963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG 0: 13
1: 55
2: 313
3: 900
4: 3924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963831228 Original CRISPR AAGAAGAAGAAGAAGAAGGC CGG Intronic
Too many off-targets to display for this crispr