ID: 963833562

View in Genome Browser
Species Human (GRCh38)
Location 3:150034055-150034077
Sequence ACCCAGTAGAAGCTTGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963833558_963833562 3 Left 963833558 3:150034029-150034051 CCAAATTGCAGTCTTAAAATAGG 0: 1
1: 0
2: 2
3: 17
4: 208
Right 963833562 3:150034055-150034077 ACCCAGTAGAAGCTTGGTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963833562 Original CRISPR ACCCAGTAGAAGCTTGGTGA AGG Intronic
904992915 1:34608155-34608177 ACAGAGTAGATGCTTAGTGATGG + Intergenic
905888160 1:41502792-41502814 ACCCAGACAAAGCTTGGTGAAGG + Intergenic
906610624 1:47199394-47199416 ATCCAGGAGAAGGATGGTGATGG + Intergenic
906649440 1:47502286-47502308 AGCCAGTAGAGATTTGGTGAAGG - Intergenic
909320875 1:74284299-74284321 ACCCTTTAGAAGCTTGCTGAGGG + Intronic
914267400 1:146049803-146049825 GCCCAATAAATGCTTGGTGAAGG + Intergenic
914812146 1:151036828-151036850 ACCCAGTAAGAGCTGGGTGGTGG - Intronic
916028241 1:160854034-160854056 ACCCAGCAGTAGCATGGTTAAGG + Intronic
919087064 1:192933134-192933156 ACTCAGTAAATACTTGGTGAAGG + Intergenic
919770370 1:201154486-201154508 AACCAATAGAAGCTAGGAGAGGG - Intronic
923870101 1:237982949-237982971 AACTAGTAGAAACTTGGTGCTGG - Intergenic
1068523156 10:58099788-58099810 GCCCAGTAGAAGGTGGGAGAAGG + Intergenic
1068565169 10:58566909-58566931 ACACAGTAGAGGCTTGGAGAAGG + Intronic
1068931383 10:62593981-62594003 ACCCAGGAGAGGCTTTGTTAAGG - Intronic
1072429568 10:95358968-95358990 CCCCCGTAGAAGCTAGGTGGGGG - Intronic
1072745423 10:97936102-97936124 TCCCAGTAGCAACTTGGGGAGGG - Intronic
1073862290 10:107760821-107760843 ACCCAGCAGAAGCCTTGGGAAGG + Intergenic
1074186925 10:111105775-111105797 TCCCAGAAGACGCTTGGTGAAGG + Intergenic
1076008052 10:126963917-126963939 AGGTCGTAGAAGCTTGGTGATGG + Intronic
1076510600 10:131011478-131011500 GGCCAGTAGAAGCTTGGTGCTGG - Intergenic
1080263682 11:30378433-30378455 TCACAGTAGAATCTTGGGGAGGG + Intergenic
1080702063 11:34652426-34652448 ACCCAGTGTAACCTTGGTTAAGG - Intronic
1081907514 11:46679082-46679104 ATCCAGAAGGAACTTGGTGAAGG + Exonic
1083101283 11:60308848-60308870 GCCCAGTAGAAGGTGGGAGAAGG - Exonic
1083366151 11:62142488-62142510 ACCCACTAGATGCTTTGTGCAGG - Intronic
1083755917 11:64791727-64791749 GCCCAGGTGAAGCTTGTTGAAGG + Intronic
1086077746 11:82872602-82872624 AGCCAGCAGAAGCTTAGCGAGGG + Intronic
1087416686 11:97865163-97865185 ACCCAGTAGAAGGAAGCTGATGG + Intergenic
1088230823 11:107671849-107671871 ACCTGGTTGCAGCTTGGTGATGG + Intergenic
1088372885 11:109110774-109110796 AACCAGCAGAAGCTGGGAGATGG + Intergenic
1090340864 11:126018992-126019014 ACCCAGCAGAAGCATGTTAACGG + Intronic
1090923062 11:131224191-131224213 GCCCAGAAGAAGCTAGGTGTGGG + Intergenic
1093304152 12:17491579-17491601 ACCCACCAGAAGCTAGGAGAAGG + Intergenic
1094013112 12:25829945-25829967 ACCCCATAGAAGCTGGGTGCAGG + Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097648679 12:62267492-62267514 ACCATGTAGAATCTTAGTGATGG - Intronic
1101415072 12:104501743-104501765 ACCCACCAGATGCTGGGTGAAGG + Intronic
1102765009 12:115424902-115424924 ACTCAGTAAAAGCCTGCTGAAGG + Intergenic
1104752658 12:131249904-131249926 ACCCAGGAGAAGTCAGGTGAAGG + Intergenic
1108757407 13:53520762-53520784 ACGTAGTAGAGGCTTAGTGAAGG - Intergenic
1117594664 14:57314184-57314206 AGCCAGGAGAAACTGGGTGAGGG - Intergenic
1120079832 14:80203185-80203207 ACCCAGGAGAAGATAGCTGAGGG - Exonic
1135005648 16:18819662-18819684 AGCCAGCAGAATCTTGGTGAAGG + Intronic
1136060246 16:27721449-27721471 AACCAGGAGAGGCCTGGTGAGGG - Intronic
1137466879 16:48717909-48717931 AACCAGTAAAAGCCTGGTGGGGG + Intergenic
1138228278 16:55317970-55317992 ACTCAGTAGATGTTTGGTAAAGG + Intergenic
1142570443 17:870168-870190 TCCCAGGAGAGGCTTGGTGTGGG - Intronic
1143542680 17:7579038-7579060 ACCCAGTAGCAGGTGGGAGAGGG - Intergenic
1146631907 17:34476199-34476221 ACCCAGAAGGAGTTTGCTGAGGG + Intergenic
1150638570 17:66933851-66933873 TCCCAGGAGACCCTTGGTGAGGG + Intergenic
1150988412 17:70226661-70226683 AGACAGGAGAGGCTTGGTGAGGG + Intergenic
1152941206 17:83173657-83173679 ACTCAGTAAATACTTGGTGAAGG + Intergenic
1154128563 18:11715781-11715803 AGCCAGTAGAAGCTGGGAGCAGG + Intronic
1158717605 18:59894547-59894569 ACCCACCAGAAGCTAGGAGAGGG + Intergenic
1159497655 18:69226467-69226489 AGCCACTGGAAGATTGGTGATGG + Intergenic
1164794312 19:31014122-31014144 ACCCAGTAGGGACTTGTTGAGGG - Intergenic
1165367294 19:35376103-35376125 ACCCAGTTGAAGCCGGCTGACGG - Intergenic
1165769691 19:38372092-38372114 ACTCGGTAGAATCTTGGTGGTGG - Intergenic
1168382247 19:55933722-55933744 ACCCAGTAGAAGCTGAGCAAGGG + Intergenic
926092366 2:10059117-10059139 ACGCAGTAGAAGCCTGCTGGTGG - Intronic
929639953 2:43568006-43568028 CCCCAGTAGTAGCTTAATGAAGG - Intronic
930677792 2:54222859-54222881 ACTCAGAAAATGCTTGGTGAAGG - Intronic
930965212 2:57314853-57314875 ACCCAGGAGTAGAATGGTGAGGG + Intergenic
933344976 2:81071855-81071877 ACCCAGTAGCAGAATGGAGAGGG + Intergenic
937339586 2:121082612-121082634 ACCCACAGGAAGCTTGGGGAGGG + Intergenic
940785841 2:157980425-157980447 ACCTAGAAGAAGTTTGCTGAAGG + Intronic
943690384 2:190863625-190863647 ACCCAGTAAAATCTCAGTGATGG + Intergenic
947799186 2:232917194-232917216 ATTCAGTAGAAGCTTGGTTTTGG - Intronic
948979738 2:241487270-241487292 ACCCAGCAAATGCTTGTTGAAGG + Intronic
1175497398 20:59424139-59424161 ACCCAGTGGAGGGTTGGGGAGGG + Intergenic
1179169674 21:38963092-38963114 ACCCAGCAGAAGCTGGGAAAAGG + Intergenic
1184773229 22:46610075-46610097 GGGCAGAAGAAGCTTGGTGAAGG - Intronic
949907534 3:8871092-8871114 ACCAAGAAGAATCCTGGTGATGG + Intronic
950239331 3:11353932-11353954 ACCCAGAAGAAGCAGGGTAAAGG - Intronic
950658480 3:14452079-14452101 GCCCAGAAGAAGCTGGGAGATGG - Intronic
951322876 3:21268673-21268695 ACCTGGTAGAAGTTTGGAGAGGG - Intergenic
956972222 3:74539466-74539488 AGACTCTAGAAGCTTGGTGATGG - Intergenic
958748960 3:98172266-98172288 ACTCAGTTGAAGCTTAATGAAGG - Intronic
959536601 3:107493359-107493381 GCCCAGGAGAAGCCTGGTGCTGG - Intergenic
961541370 3:127602189-127602211 ACCAATTAGAAGTTTGCTGAGGG + Intronic
962966854 3:140363791-140363813 ACCCTCTAGTTGCTTGGTGAGGG + Intronic
963833562 3:150034055-150034077 ACCCAGTAGAAGCTTGGTGAAGG + Intronic
966256598 3:177924123-177924145 CCTCAGTAGAATCTTGCTGAAGG - Intergenic
976785598 4:88816655-88816677 CCCCATTAGAAGCTTAGTAAAGG - Intronic
976904008 4:90213623-90213645 AACCAGCAAATGCTTGGTGAGGG + Intronic
977520673 4:98079396-98079418 ACCCAGTATAAGCTGGCTGCAGG + Intronic
984587954 4:181584398-181584420 ATACAGAAGAAGCTTGGTGGAGG - Intergenic
989672436 5:43934775-43934797 ACCCAATAAATGCTTGCTGAAGG + Intergenic
990698532 5:58450292-58450314 AGGCAGTAGAAGGTTGGAGAAGG - Intergenic
991261099 5:64669149-64669171 ACCCAGCTGAGACTTGGTGATGG - Intergenic
997599780 5:135131383-135131405 AGCTAATAGAAGCTTTGTGATGG + Intronic
1003352999 6:5337649-5337671 AACAAATAAAAGCTTGGTGAAGG - Intronic
1004505328 6:16242523-16242545 AACCAGCAGAAGCTGGGAGAAGG - Intronic
1006399572 6:33809099-33809121 ACCCAGAAGCAAGTTGGTGACGG - Intergenic
1012502443 6:99904015-99904037 ACCCAGTAGAACTTTGGAGCTGG - Intergenic
1015318613 6:131846194-131846216 ACCAAGTAGATGGTTGGTGGAGG - Intronic
1022506989 7:30913609-30913631 GCCCAGGAGAGGCTAGGTGAAGG + Intronic
1024683436 7:51718240-51718262 AACCAGTAGAAGGTGAGTGACGG - Intergenic
1028687939 7:93613486-93613508 TCCAAGTATAAACTTGGTGAAGG - Intronic
1032862101 7:135890120-135890142 AACAATTAGAAGATTGGTGAAGG - Intergenic
1033246394 7:139719955-139719977 AGCCAGTGGAAGTTTGGAGAGGG - Intronic
1036476802 8:9101020-9101042 ACACATTAGATTCTTGGTGAGGG + Intronic
1038521432 8:28235700-28235722 ACCTTGTGGTAGCTTGGTGAGGG - Intergenic
1040598749 8:48864190-48864212 TCCCACTAGAAGCTAGGTGGAGG - Intergenic
1041249110 8:55917615-55917637 ACCCAGTAGGAGCTTACTTAGGG - Intronic
1042089248 8:65140793-65140815 AGCCAGGAAAAGCTTGGTTATGG + Intergenic
1044048536 8:87469223-87469245 CCCCACTAGAAGCTTTGTGAAGG - Intronic
1047469563 8:125156493-125156515 TCCTACTAGAAGCCTGGTGAGGG + Intronic
1049987544 9:965778-965800 GCCCAGGAGAAGGTTGGTGCAGG + Intronic
1057878308 9:98774267-98774289 ATCCAGAAGAAGCCTGGTGTTGG - Intronic
1058060962 9:100495599-100495621 ACCTAGTAGATGCTTAGTAATGG + Intronic
1060629885 9:125146300-125146322 ACACACTAGATGCTTGGGGAAGG - Intergenic
1190388981 X:49912728-49912750 CCCTAGTGTAAGCTTGGTGAAGG - Intergenic