ID: 963834876

View in Genome Browser
Species Human (GRCh38)
Location 3:150048150-150048172
Sequence TGCTCCTTACCTCCTTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963834876_963834881 8 Left 963834876 3:150048150-150048172 CCCTGGGAAGGAGGTAAGGAGCA 0: 1
1: 0
2: 3
3: 39
4: 311
Right 963834881 3:150048181-150048203 AAAATACCAAGTAAAAGGAGAGG 0: 1
1: 0
2: 3
3: 42
4: 499
963834876_963834883 20 Left 963834876 3:150048150-150048172 CCCTGGGAAGGAGGTAAGGAGCA 0: 1
1: 0
2: 3
3: 39
4: 311
Right 963834883 3:150048193-150048215 AAAAGGAGAGGATCTGAGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 299
963834876_963834880 3 Left 963834876 3:150048150-150048172 CCCTGGGAAGGAGGTAAGGAGCA 0: 1
1: 0
2: 3
3: 39
4: 311
Right 963834880 3:150048176-150048198 TAAGAAAAATACCAAGTAAAAGG 0: 1
1: 1
2: 5
3: 84
4: 840

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963834876 Original CRISPR TGCTCCTTACCTCCTTCCCA GGG (reversed) Intronic
900007464 1:72030-72052 TTCTGCCTGCCTCCTTCCCAGGG - Intergenic
900367510 1:2317302-2317324 TCCTCCTTTCCTCCCACCCATGG - Intergenic
901544309 1:9943922-9943944 AGCTCATTACCTCCTTCTCAAGG - Intronic
901664864 1:10820311-10820333 TGGGCCTTGCCTGCTTCCCACGG - Intergenic
901808068 1:11750258-11750280 TGCTCCTGACCTCCGTCTCTTGG + Exonic
904664433 1:32108814-32108836 CGCTCCTTTTCTCCTTACCAGGG - Intronic
905175151 1:36130713-36130735 TTCTCCCTACCTCCACCCCAGGG + Intergenic
905299464 1:36976670-36976692 TGATCTTTACCCCCTCCCCATGG + Intronic
906790332 1:48653674-48653696 TGCTCTCTCCCTCCTGCCCATGG - Intronic
907255019 1:53172754-53172776 TTCTCCTTGCCTCCATCCCTCGG + Intergenic
907405246 1:54250089-54250111 TGCCCCTTGCCCCCTTCCCTAGG + Intronic
910207123 1:84759305-84759327 TCCTCCCCACCTCCTTCCCGTGG + Intergenic
912069084 1:105785521-105785543 TTCTCCTTTCCTCCTCTCCAAGG + Intergenic
914997576 1:152558443-152558465 CACTCCTAACCTCCTGCCCATGG - Intronic
915002316 1:152604520-152604542 TGCTCCTAACCTCCTGCCCATGG + Intergenic
915249723 1:154579452-154579474 TGCCCCTTACTTTCCTCCCAAGG - Exonic
915275516 1:154785419-154785441 GGCCCTTCACCTCCTTCCCAAGG + Intronic
915309890 1:155001641-155001663 TGCTCCCCACCTCCATCCCGCGG - Intergenic
915323242 1:155067483-155067505 CACTCCTTCCCTCCTTCCCAAGG - Intronic
915349079 1:155213379-155213401 TGCCCCTTACCTCCATCCCAGGG - Exonic
915352266 1:155234006-155234028 TGCCCCTTACCTCCATCCCAGGG - Intergenic
915443042 1:155958446-155958468 AGCTGCTTCCCTCTTTCCCAAGG + Intronic
915610016 1:156984311-156984333 TGCTGCATCCCTCCTGCCCACGG - Intronic
916511177 1:165473654-165473676 AGCTCCCAACCTCCTGCCCATGG + Intergenic
916923940 1:169498020-169498042 TCCACCTTAACTCCTTCCCTGGG - Intergenic
917508425 1:175649703-175649725 TGCTCCTAACTGCCATCCCATGG + Intronic
918567121 1:185947629-185947651 TGGCCCTTGCTTCCTTCCCAAGG + Intronic
919694102 1:200555972-200555994 TGTTACTTACCCCCTTCCAAGGG - Intronic
919831474 1:201543827-201543849 TTCCCCTTCCCTCCTCCCCAAGG + Intergenic
920088917 1:203438291-203438313 TCCTCCTTTTCTCCTTCCCCTGG - Intergenic
920410383 1:205755112-205755134 TGGTCCTTACCCACTTCACAAGG + Intergenic
920904632 1:210150486-210150508 TCCTCCTTACCTAGTTCCCTGGG + Intronic
922445987 1:225697801-225697823 TGATCCCTTCCTCCTTACCATGG + Intergenic
923620832 1:235577809-235577831 TGCTCCTCTCCTCCTTCCCCAGG + Intronic
1064162218 10:12956445-12956467 TGCTCCCTTCTTCCTACCCATGG + Intronic
1064252216 10:13715180-13715202 GGCTCCTGACCTCCCACCCAGGG - Intronic
1064688858 10:17893160-17893182 TCTTCCTTCCTTCCTTCCCAAGG + Intronic
1067279765 10:44862372-44862394 TGCTCCCCAACTCCCTCCCATGG + Intergenic
1067912074 10:50355927-50355949 TGCTCCTTACCTCCCAGACAGGG - Intronic
1068091466 10:52437772-52437794 TTCTCCCTACCTTCTTCTCAAGG - Intergenic
1068659364 10:59607573-59607595 TGCTCCCTACCTCCTTATAAAGG - Intergenic
1069632358 10:69904655-69904677 TGCTGCTGACCTACTTTCCATGG + Intronic
1069712130 10:70496450-70496472 CTCTCCTGACCGCCTTCCCAAGG + Intronic
1069731010 10:70613438-70613460 TACTACTTCCCTCCTTCCCAAGG + Intergenic
1069782025 10:70962860-70962882 TGCTCCTTTCCTGCTCCCTAAGG - Intergenic
1069948318 10:72002308-72002330 TTCTCCTTCCCTCCCTTCCAGGG - Intronic
1070398445 10:76032605-76032627 ACCTCCTTCCCTCGTTCCCAGGG - Intronic
1071830531 10:89367641-89367663 TGCTCCTTCACACCTTCCCCTGG + Intronic
1072776486 10:98201548-98201570 TGTGCCTTGCCTCCTTCTCAAGG + Intronic
1075225411 10:120624558-120624580 TCCTTCTTGCCTCCTGCCCAGGG - Intergenic
1075701828 10:124474878-124474900 TCCTGCTGGCCTCCTTCCCAGGG + Intronic
1076078957 10:127560561-127560583 TGCTCCTTTGTTCTTTCCCATGG - Intergenic
1076356392 10:129856679-129856701 TGCCCCATTCCTCCTTCCCTTGG - Intronic
1076817980 10:132923945-132923967 TGCTCCTTCCCACCTTCTCTGGG - Intronic
1077264687 11:1642820-1642842 CCCTCCTTCCCTCCCTCCCAGGG + Intergenic
1077725881 11:4674430-4674452 TGCTCCATACTACGTTCCCAAGG - Intergenic
1078355519 11:10629142-10629164 TGCTCCTTCTCGACTTCCCAGGG + Intronic
1079361292 11:19772624-19772646 AGCTCATTCCCTCCTCCCCATGG + Intronic
1080875099 11:36267618-36267640 TTCCCCTTCCCTCTTTCCCATGG + Intergenic
1081602863 11:44507302-44507324 TGCCCCTGACCACCTTCCTAAGG - Intergenic
1081911456 11:46702494-46702516 GTCTCCTCACCTCCCTCCCAAGG - Intronic
1083288472 11:61676245-61676267 TGCCCCCTGCCTCCTCCCCATGG - Intergenic
1084802055 11:71550705-71550727 TCCTCCTTAACTTCTTCCAATGG - Intronic
1085052978 11:73389198-73389220 TGCGGCTTTTCTCCTTCCCAGGG - Intronic
1086975016 11:93121303-93121325 TGCTGCTTACCTACTTGCTAGGG - Intergenic
1087073428 11:94104837-94104859 TGAGCCTTTCCTCCTTCCCAGGG + Intronic
1088762992 11:112949848-112949870 TGCTCCTTACCCTCGTCCCTTGG - Intergenic
1088872913 11:113907893-113907915 TGCTCCTGACTTCCCTCCCCTGG + Intronic
1089738042 11:120563438-120563460 TCCACCCTACTTCCTTCCCAGGG - Intronic
1090049257 11:123362906-123362928 TTCTCTTTCTCTCCTTCCCAGGG - Intergenic
1090254147 11:125271462-125271484 TCTTCCCTACCTCCATCCCAAGG + Intronic
1090332614 11:125943399-125943421 CCCTCCTTCCCCCCTTCCCAAGG - Intergenic
1090874891 11:130780054-130780076 TGCTCCTTGCCGCCTTCTCCTGG + Intergenic
1091658230 12:2361516-2361538 GCCTCCCTCCCTCCTTCCCAGGG + Intronic
1091974973 12:4817119-4817141 TCCTCCCCACTTCCTTCCCATGG - Intronic
1091975712 12:4822985-4823007 CGTTTCTTATCTCCTTCCCAAGG - Intronic
1092850010 12:12618333-12618355 TGCTCCTTACCTCCTAGACGGGG + Intronic
1094498558 12:31004433-31004455 TGATCTCTATCTCCTTCCCAGGG - Intergenic
1095321242 12:40830222-40830244 TGCTCAGTTCCTGCTTCCCACGG + Intronic
1095581318 12:43803336-43803358 TGCTTCTGACCTCCTTACCCTGG - Intronic
1095924807 12:47567638-47567660 AGGTCTTTCCCTCCTTCCCAAGG - Intergenic
1096692656 12:53330590-53330612 TGCTCCAAACCTACTTCCAAGGG - Intronic
1097173968 12:57132261-57132283 TACCCCTCACCTCTTTCCCAGGG - Intronic
1097363647 12:58686565-58686587 TGCTCCCTGCCTTCTTCCCTAGG + Intronic
1098088929 12:66880164-66880186 TGCTCCTTCCCTTCTTTGCATGG - Intergenic
1098317744 12:69209766-69209788 TGCTCCCTACTTTCTTCCCCCGG - Intergenic
1102545963 12:113655731-113655753 TGCTCTTTCCCTCCCTCCCCAGG - Intergenic
1103402380 12:120651779-120651801 TGTTCCTTAGATCCTTCCAAGGG + Intronic
1103955828 12:124576294-124576316 TGCCCCTTCCCTTCTTCCCAGGG + Intergenic
1104062487 12:125280543-125280565 TGCTCCCTGCCTCCCTCCCCTGG + Intronic
1105714807 13:23052480-23052502 TGCTGCTTACCTCTTTCCTCTGG - Intergenic
1105730551 13:23211258-23211280 GGCTCCTCTCCTCCTTCCCCAGG - Intronic
1106328395 13:28716684-28716706 TACTCATTTCCTCATTCCCATGG - Intronic
1106411650 13:29515122-29515144 TGCTTCTTACCACCTGCCCAGGG + Intronic
1106712649 13:32354574-32354596 TACTCCTTACCTCCTTCACCAGG - Intronic
1107479813 13:40776802-40776824 AGCCCATTACCTCCTTCACAAGG + Intergenic
1107655419 13:42588291-42588313 TGCTTCCTACCTTCTTCCCTGGG - Intronic
1108164033 13:47673479-47673501 TGCAGCTTAACACCTTCCCATGG + Intergenic
1108324820 13:49319426-49319448 TGCCCCTCACCTCCATCCCCTGG - Intronic
1108511070 13:51156191-51156213 TGCTCCCTACCTCCCTCCTATGG - Intergenic
1108525030 13:51279325-51279347 TGCTCCTTACCCCATCCCAAAGG + Intronic
1110816410 13:79865225-79865247 TTTTCCTTTACTCCTTCCCAAGG - Intergenic
1111565607 13:90010952-90010974 TCCTCCTCACCACCTTACCAAGG - Intergenic
1112682115 13:101778588-101778610 TTCTCCTGTCCTGCTTCCCATGG + Intronic
1112880319 13:104099037-104099059 CACTCCTTAGCTCCTTTCCAAGG + Intergenic
1113634164 13:111908612-111908634 TGCTGCTTGCCTCCTTCTCCTGG + Intergenic
1115952169 14:38733556-38733578 TGCTGCTTTCCTCCTTCTCATGG - Intergenic
1117478181 14:56118340-56118362 TCCTCCTTCCCTCCCTCCCGCGG + Intronic
1117809593 14:59532685-59532707 TGTTCCTTTCCTCCCTCCCCTGG + Intronic
1118635523 14:67745516-67745538 TGCTCATTATCTCCTTTCCCCGG - Intronic
1121138955 14:91524156-91524178 TGCTTCTCACCTCCCTCCCCAGG + Intergenic
1121589017 14:95085287-95085309 TGCTCCTTGCATCTTTCCAAGGG + Intergenic
1122419837 14:101568532-101568554 TGCTCCTTCTCCCCTTCCCCCGG - Intergenic
1122826436 14:104373056-104373078 TTCTCCCATCCTCCTTCCCAAGG + Intergenic
1123134873 14:106018308-106018330 TCTTCCTGACCTCCTGCCCAGGG + Intergenic
1123136032 14:106027864-106027886 TCTTCCTGACCTCCTGCCCAGGG + Intergenic
1123165388 14:106320577-106320599 TCTTCCTGACCTCCTGCCCATGG + Intergenic
1123412557 15:20072675-20072697 TGCTCCCTGCCGCCTCCCCAGGG + Intergenic
1123521899 15:21079788-21079810 TGCTCCCTGCCGCCTCCCCAGGG + Intergenic
1123583661 15:21738323-21738345 TCTTCCTGACCTTCTTCCCATGG + Intergenic
1123620311 15:22180926-22180948 TCTTCCTGACCTTCTTCCCATGG + Intergenic
1124417059 15:29480884-29480906 GCCACCTCACCTCCTTCCCATGG - Intronic
1125686143 15:41564505-41564527 CCCTCCTTCCCTCCCTCCCAAGG - Intronic
1127644073 15:60942783-60942805 TCCTCCCCACCTCCATCCCAGGG - Intronic
1127759098 15:62120559-62120581 CCCTCATTCCCTCCTTCCCAAGG + Intergenic
1128946406 15:71825312-71825334 TTGTGCTTCCCTCCTTCCCATGG - Exonic
1130046502 15:80449901-80449923 TGCTGCTTCCCTTCTTCCCCTGG + Intronic
1130375474 15:83325243-83325265 TGCTCCCCACCCCCATCCCATGG + Intergenic
1131053850 15:89364215-89364237 TGCTCCTTTCCTGAGTCCCACGG - Intergenic
1132415159 15:101614184-101614206 TGCGCCCTTCCTCCTTCCCCAGG + Intergenic
1132446086 15:101920098-101920120 TTCTGCCTGCCTCCTTCCCAGGG + Intergenic
1133235094 16:4384048-4384070 TGCTCCCTGCCTCCTGCCCCTGG + Intronic
1133620643 16:7522993-7523015 TCCTCCTTGCCTCATCCCCAGGG + Intronic
1134337681 16:13316354-13316376 TTCTGCTGACCTCCTTCCCCAGG + Intergenic
1135597964 16:23757458-23757480 TGCTCCCAACCTCCTCCCCCAGG - Intronic
1135938561 16:26801491-26801513 TGTTCCTTCCCACCTTCTCAGGG - Intergenic
1137336435 16:47554127-47554149 TGCCCCTTCCCTCTGTCCCAGGG + Intronic
1137540374 16:49357550-49357572 TGCTCTCTTCCTCCTTCCTATGG - Intergenic
1138476192 16:57271907-57271929 TGCTTCCTCCCTCCTTCCCAGGG + Intronic
1138819327 16:60240047-60240069 TGCTCCTTTCCTCTATCCCCTGG + Intergenic
1140203344 16:72912633-72912655 CGCTCCTATCCTCCCTCCCAAGG - Intronic
1140476386 16:75241440-75241462 TGCTCCCTGCCGCCTCCCCAGGG + Intronic
1141166379 16:81663806-81663828 TGCACTTTACCCCCTGCCCAGGG + Intronic
1141183427 16:81770249-81770271 TGCTCATCACCACCTTCCCAAGG + Intronic
1141271728 16:82547060-82547082 TTCTGCTTGCCTCCCTCCCATGG - Intergenic
1141360193 16:83388523-83388545 TGCTCCTCAGCTCCTGCCCATGG - Intronic
1142599461 17:1046544-1046566 TGCTCCTCTCCTTCCTCCCAGGG + Intronic
1143574415 17:7782077-7782099 TGGTACTTACCTGCCTCCCAGGG - Intronic
1143875175 17:9985865-9985887 TGCTGCTTCCTTCCTTCCCCGGG + Intronic
1144274596 17:13653505-13653527 TGCTCTTCTCCTCCTACCCAGGG - Intergenic
1145888581 17:28399167-28399189 ACCTCCCTCCCTCCTTCCCAAGG + Exonic
1146255475 17:31389690-31389712 CACTCCCTACCTCCTTGCCAGGG + Intergenic
1146624012 17:34422373-34422395 TGCTTTTTAACTCCTGCCCAAGG + Intergenic
1147034686 17:37671255-37671277 TGCTTCTTATCCCATTCCCATGG - Intergenic
1149571985 17:57678573-57678595 TGCTCCCTCCCTCCCTCCCCTGG + Intronic
1149783883 17:59419648-59419670 TCCATCTTTCCTCCTTCCCAGGG - Intergenic
1156254858 18:35385287-35385309 TGCTCCTCACCTCTCTTCCAAGG + Intergenic
1157276206 18:46312747-46312769 TTCTCCTTCCCACCTGCCCAGGG + Intergenic
1157722116 18:49933133-49933155 AGCTCCCTACCTGCTTCCCCAGG + Intronic
1160639221 19:113617-113639 TTCTGCCTGCCTCCTTCCCAGGG - Intergenic
1160888764 19:1365829-1365851 TGCTCCTCACTGCCTTCTCACGG + Intronic
1161352967 19:3803947-3803969 GGCTCTTCACCTCCTTCTCAGGG - Intergenic
1161576686 19:5058371-5058393 TTCTCCCTGCCTCCATCCCAAGG - Intronic
1161579349 19:5072177-5072199 TGCTCTCTTCCCCCTTCCCATGG + Intronic
1161991591 19:7687340-7687362 TGCTCCTGGCCTCCCTCCCGTGG + Exonic
1162796139 19:13088610-13088632 TGCCCCTCACCTCCATCCCTGGG + Intronic
1164596937 19:29536391-29536413 TGCCCCCTCTCTCCTTCCCAAGG + Intronic
1164728779 19:30485235-30485257 TGCACGTTTCCTTCTTCCCATGG + Intronic
1164957883 19:32402785-32402807 TGTTCATTACATCCATCCCATGG - Intergenic
1165521166 19:36315225-36315247 TTTTCCTTATCTCCCTCCCAAGG - Intergenic
1165622901 19:37263365-37263387 TTTTCCTTATCTCCCTCCCAAGG + Intergenic
1165900400 19:39166975-39166997 TGCCCCTTGCCCCCTTCCCTTGG + Intronic
1166920653 19:46226934-46226956 GTCTCCTGACCTCCTACCCAAGG - Intergenic
1167011755 19:46813343-46813365 TCCTCCTTCCCTGCTCCCCACGG - Intergenic
1167255736 19:48427422-48427444 TCCTTCTTGCCTCCTTGCCAGGG + Intronic
1167304349 19:48698368-48698390 AGCTCCCTACCTCCTTACCCAGG - Intronic
1168161567 19:54513509-54513531 CTCTCCTGAGCTCCTTCCCAGGG - Intergenic
1168648982 19:58080751-58080773 TGCTCCTTACATCCTGGGCAGGG + Intronic
926003625 2:9354137-9354159 TGTTCCTTCCATCCCTCCCAGGG - Intronic
926193518 2:10745769-10745791 TCCTCCTTTCCTCCTCCCCCAGG + Intronic
927703664 2:25283870-25283892 GGTTCCTCACCTGCTTCCCAGGG - Intronic
928437390 2:31263675-31263697 TACTTCTCACCTCCTTCCTAGGG - Intronic
933520967 2:83372942-83372964 TGTACCTTAACCCCTTCCCAGGG - Intergenic
934909917 2:98242286-98242308 TGCTCAATACCTCATTTCCAAGG - Intronic
935204359 2:100884752-100884774 TGAGTCTTTCCTCCTTCCCATGG - Intronic
935494791 2:103766936-103766958 TCCACCTCACCTCCTTTCCATGG + Intergenic
937455826 2:122040842-122040864 TGGTCCTTTCCCCCTTCCCCAGG - Intergenic
940144515 2:150532266-150532288 TCCTCCTTATCCCCTTCCAATGG - Intronic
942827384 2:180195146-180195168 TGCTCCTGACCTCCTACCCCTGG + Intergenic
943457939 2:188130648-188130670 ACCTCCTTACCTCCCTCTCAAGG + Intergenic
943628394 2:190223687-190223709 TGTTCCTCACTTCCTTGCCAAGG - Intronic
944381653 2:199117430-199117452 TGGTTCATACCTCCTTTCCAAGG - Intergenic
945335230 2:208583977-208583999 TGCTCCTTATCTCCAACCCTGGG + Intronic
945834508 2:214822764-214822786 TCCTCTCTTCCTCCTTCCCATGG - Intergenic
946138697 2:217669410-217669432 TTCTTCTTACATCCTTCTCAGGG - Intronic
947591664 2:231389315-231389337 TGGTCCTCAGCCCCTTCCCAAGG + Intergenic
948080322 2:235200323-235200345 CCCTCCCTACCTCCTTCACATGG - Intergenic
1168748505 20:265454-265476 TCCTCCTTCTCTCCTTTCCAAGG - Intergenic
1168761040 20:349617-349639 TGCACCTTACCTGCTCCCCAGGG + Exonic
1169329714 20:4706679-4706701 TGCCCCTCACCTTCTTCCCAGGG + Intergenic
1169419408 20:5447760-5447782 TACTCCTTGCCTCCCTCCCAAGG + Intergenic
1171391871 20:24806866-24806888 GGCTCCTTCCCTGCGTCCCATGG - Intergenic
1172014819 20:31867047-31867069 TACTTCTTACCCCCATCCCAGGG - Intronic
1173084700 20:39904562-39904584 TGCTCCTGCCCTTTTTCCCAGGG - Intergenic
1173524459 20:43721401-43721423 TGCTCCCTCCCTGCTGCCCATGG - Intergenic
1174178025 20:48657232-48657254 AGCTCCTTCCCTCCTCACCAAGG + Intronic
1174365568 20:50054317-50054339 GGCTCCTTACCCCTTTCCCTGGG - Intergenic
1174751578 20:53116488-53116510 TGCTCCTGCCCTCCACCCCACGG + Intronic
1174977815 20:55354329-55354351 TTCTGCCTACCTGCTTCCCATGG + Intergenic
1175220773 20:57415193-57415215 GGCTCCCAACCTCCTGCCCAGGG - Intergenic
1175338285 20:58210626-58210648 TGCTCAGCACCACCTTCCCAGGG + Intergenic
1175594978 20:60223860-60223882 TGTCCCTCACCGCCTTCCCAGGG + Intergenic
1175605882 20:60311889-60311911 TAGTCCTTGTCTCCTTCCCATGG - Intergenic
1176965553 21:15208308-15208330 TGCTCCCTTCTTCCTTCCCATGG + Intergenic
1178918883 21:36725420-36725442 TGCTGCTTACCACCTTCCAATGG - Intronic
1181362596 22:22349578-22349600 TCTTCCTTGTCTCCTTCCCAGGG + Intergenic
1181365363 22:22372369-22372391 TCATCCTTGCCTCCTTCTCAGGG + Intergenic
1182145914 22:27996616-27996638 TGCTCATCTCCTCCTTGCCATGG + Intronic
1183280365 22:36929004-36929026 AGCTCCCTTCCTCCTGCCCAGGG - Intronic
1183307301 22:37089549-37089571 CCCTCCTGCCCTCCTTCCCAGGG + Intronic
1184501749 22:44878827-44878849 AGCTCCCTCCCTCCCTCCCAGGG - Intergenic
1185040806 22:48503230-48503252 TGCTCCCGAGGTCCTTCCCAGGG - Intronic
1185310256 22:50150369-50150391 TGCCCCTTGCCTCTTGCCCATGG - Intronic
949418305 3:3837006-3837028 TCCTTCACACCTCCTTCCCATGG - Intronic
950129018 3:10529075-10529097 TGCTACTTCCCACCTTCCCGGGG + Intronic
950458008 3:13104103-13104125 TCTTCCTTACCTGCTCCCCATGG + Intergenic
953210073 3:40867976-40867998 CACTCCCTACCTCTTTCCCATGG - Intergenic
954108164 3:48420152-48420174 TGCTCCTGACACCCTTCCCGTGG - Exonic
955645427 3:61132402-61132424 TGCTCATCTCTTCCTTCCCAGGG - Intronic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
956658237 3:71573755-71573777 TGCCCCACCCCTCCTTCCCAAGG + Intronic
957157722 3:76566919-76566941 TGCGACTTAGTTCCTTCCCATGG - Intronic
960160267 3:114343082-114343104 TGCTCATCACCTTCTTCTCAAGG + Intronic
960230679 3:115222745-115222767 TGCTCCTTCCTTCATTCCAATGG + Intergenic
961141814 3:124562441-124562463 TGCCCCTTTACTCCTTCCAAGGG - Intronic
962912566 3:139866832-139866854 TGCACCTTACCTCCATCGCAAGG - Intergenic
962994591 3:140613040-140613062 TTCTTCTTACCTCCTTCCTCAGG + Intergenic
963226144 3:142863668-142863690 TGCACCTAACCACCATCCCAAGG - Intronic
963834876 3:150048150-150048172 TGCTCCTTACCTCCTTCCCAGGG - Intronic
965058422 3:163751560-163751582 TGATCCTTGGTTCCTTCCCATGG + Intergenic
967503213 3:190223414-190223436 TGCTGCTCAGCTCCTTCCTAGGG + Intergenic
967765916 3:193279356-193279378 TGCCACTTACCTCCATTCCACGG + Exonic
967954839 3:194870113-194870135 TCCTCCTTAGAGCCTTCCCAGGG - Intergenic
968486577 4:865907-865929 GGCGCCTGACCTCCTCCCCATGG + Intronic
968854897 4:3112428-3112450 TGCTCCTGCCTTCCTCCCCAAGG + Intronic
969288203 4:6221603-6221625 AGCTCCATCCCTCCTTCCAATGG - Intergenic
975883062 4:78933864-78933886 TGCTCTTTTCCTCCATCCCTAGG - Intronic
977792689 4:101127037-101127059 TGCCCCTTACACCCATCCCAGGG + Intronic
978301184 4:107270683-107270705 TGCTCCTTGCCTACTGCCCAGGG - Intronic
980060640 4:128125421-128125443 TGCTTCCTACCTGCTCCCCAAGG + Intronic
985219844 4:187692640-187692662 GGCTCACCACCTCCTTCCCATGG + Intergenic
985769060 5:1797651-1797673 GGCTCCTTTCCTCCTGGCCAGGG - Intergenic
986889515 5:12284398-12284420 TGCTCCTTCCCACCCTCCCAAGG + Intergenic
987070972 5:14336715-14336737 GGCACCTTACCTCTTTCACATGG - Exonic
987087549 5:14484317-14484339 TTATCCTTACTTACTTCCCAGGG - Intronic
988366755 5:30310269-30310291 TGCTCCTTACATCCCAGCCATGG + Intergenic
989104332 5:37846803-37846825 TGCTCCTTCTCTCCCTCCCTGGG + Intergenic
989173046 5:38492713-38492735 TGCTCCTTACCTCTCTCTCAGGG - Intronic
989231941 5:39096745-39096767 TCCTCTTTCCCTCCTTCCTAGGG - Intergenic
991390856 5:66142030-66142052 TCCTCCTTCCCTCCTTGCCTGGG + Intronic
991914768 5:71594672-71594694 TTCTCCCTACCTCCTTCCCCAGG - Intronic
992388424 5:76308323-76308345 TCCTCCTTCCCTCCCTCCCATGG - Intronic
992773499 5:80070209-80070231 TGCTCCTTTGCTCAATCCCAGGG - Intronic
993066716 5:83108997-83109019 TTATTCTTACCTCCTTCCAAAGG + Intronic
993380951 5:87207199-87207221 TGTCCCTCACCTCCCTCCCAAGG + Intergenic
994238276 5:97391245-97391267 TGCCCCTTCCTTCCTTTCCAAGG + Intergenic
995244047 5:109917426-109917448 ACCTTCTTACCTTCTTCCCAAGG - Intergenic
995333023 5:110966751-110966773 TTCTCCATACCTGCTTCTCAGGG - Intergenic
996366181 5:122703653-122703675 GGTTCCATACCTCCTTCCAAAGG - Intergenic
996839309 5:127829014-127829036 TCCTCATTACCTCTTTCCAAAGG - Intergenic
998415129 5:141940645-141940667 TGCTCCCTGCCTCCTTTTCAGGG + Exonic
1000264280 5:159619801-159619823 TGCTGCCTCCCTCCTTCACAGGG - Intergenic
1000268542 5:159660661-159660683 TTCTCCTTACTTCCTGCCCTAGG - Intergenic
1000401377 5:160831712-160831734 TGCTGAATACCTCCTTACCAGGG + Intronic
1001335887 5:170796113-170796135 GGCTCCTGGCCTCCTCCCCAAGG - Intronic
1001409184 5:171498183-171498205 TGCATCTTACCCCTTTCCCAGGG + Intergenic
1002175686 5:177399912-177399934 TGCTCCTTGGCGCGTTCCCAGGG - Intergenic
1002710807 5:181193952-181193974 ATCTCCTCACCCCCTTCCCAGGG + Exonic
1002746572 6:62023-62045 TTCTGCCTGCCTCCTTCCCAGGG - Intergenic
1002875075 6:1203152-1203174 AGCTCCTTCTCACCTTCCCATGG + Intergenic
1004619759 6:17322322-17322344 TGCTCGTTACTTCCTCCCAAGGG - Intergenic
1005209143 6:23440768-23440790 TGCTCCTGGCCTCCAGCCCACGG + Intergenic
1005675054 6:28145259-28145281 TTGTCCTTACCCCCATCCCAGGG - Intronic
1006475017 6:34247863-34247885 ACCTCCCTTCCTCCTTCCCAGGG - Exonic
1007336815 6:41160386-41160408 TACTCCTGACCTCATTTCCATGG + Intronic
1007915396 6:45556940-45556962 TGCTGCTTTCTTCTTTCCCAGGG + Intronic
1008129214 6:47701453-47701475 AGCTCCACATCTCCTTCCCAAGG - Intronic
1008544698 6:52574798-52574820 TGGTACCTACCTCCTTCCCTGGG - Intronic
1012873120 6:104695375-104695397 TGCTCCTTTCCTGGGTCCCAGGG - Intergenic
1013192937 6:107819198-107819220 TGCTCCATACCACTTTCCCCTGG + Intronic
1014263946 6:119252862-119252884 TGGTCATTACCAACTTCCCATGG - Intronic
1014294604 6:119603443-119603465 TGCTCCCTAACTCCTTTCCAGGG - Intergenic
1015774935 6:136804478-136804500 TGCTCCCCTCCTCCTTCCCCAGG - Intergenic
1015886495 6:137923576-137923598 TCCTTCTTACCTTCATCCCAGGG - Intergenic
1016463737 6:144305764-144305786 TTCACCTCACCTCCTTCCCAGGG - Intronic
1017184824 6:151590036-151590058 TTCTCCTTACCTCCTTCACCTGG + Intronic
1018324596 6:162651673-162651695 TGCTTTTTTCCTTCTTCCCATGG - Intronic
1019165514 6:170095373-170095395 GCCTCCTCACCTCCTGCCCAGGG - Intergenic
1020498222 7:8883645-8883667 TCCTCCTTACCTCCAACCCCCGG - Intergenic
1021165259 7:17331242-17331264 TGCTCCTTAAGTCCTTACCAAGG - Intronic
1021540907 7:21757038-21757060 TCCTCCTTCCCTCCATCCAATGG - Intronic
1023131899 7:37011843-37011865 TCCTCCTTCCCTCTTTCCCAGGG + Intronic
1026496959 7:70911814-70911836 TCCTCATTTCCTCTTTCCCAGGG + Intergenic
1026849359 7:73715481-73715503 TGCTCCTTACCTCCCTAGCATGG + Intronic
1028947688 7:96599460-96599482 GGCTACTTGCCTCATTCCCAAGG + Intronic
1029345468 7:99975596-99975618 TGTTCCTTCCCTCCTTCCGATGG - Intronic
1029346319 7:99981176-99981198 TGTTCCTTCCCTCCTTCCGATGG + Intergenic
1029558854 7:101289340-101289362 TGTTCCTTCCCTCCTTCCGATGG - Intergenic
1029782373 7:102748465-102748487 TGCTCTTTACTTTCTTACCAAGG + Intergenic
1030815808 7:114035985-114036007 TCCTTCATACCTCCTTCCCTAGG + Intronic
1031412333 7:121455412-121455434 TGCTCTTTACCTCCTCCTTAAGG + Intergenic
1032758642 7:134916381-134916403 TATTCATTTCCTCCTTCCCAGGG - Intronic
1032864624 7:135913576-135913598 TGCTCCTCTCCTCCTTCACAGGG - Intergenic
1033762772 7:144453963-144453985 TGCTACTTACTTCCTTCCCTGGG + Intronic
1034545623 7:151786777-151786799 TTCTTCTTTCCTCCTTCCCTGGG - Intronic
1035294036 7:157857825-157857847 TGGTCCTGACCTCCATCCCGAGG + Intronic
1035823032 8:2615602-2615624 TGCTCCCTACCTCCTATCCCAGG + Intergenic
1036628866 8:10496465-10496487 TCTTCCTTTCCTCATTCCCAGGG - Intergenic
1038093455 8:24280747-24280769 TGCTCCTCACCTTTCTCCCATGG - Intergenic
1038342316 8:26696933-26696955 TGCTCCTTGCCTTCTCCCAAAGG - Intergenic
1041238927 8:55832117-55832139 TGCCCCTCCCCTCCTTCCCCAGG - Intergenic
1043069450 8:75620424-75620446 TCCTTCATACCTCCTTCCCATGG - Intergenic
1043218561 8:77628263-77628285 TTCTCCATGCCTCCTTCCCTGGG + Intergenic
1044463457 8:92475777-92475799 TGTGAATTACCTCCTTCCCAAGG + Intergenic
1044636133 8:94326209-94326231 TGCTCATGACTTTCTTCCCAAGG - Intergenic
1045351952 8:101349531-101349553 TTCTCCTTCCCTCTCTCCCAGGG - Intergenic
1045557650 8:103230424-103230446 TTCTTCTTACCTACTTCACAAGG - Intergenic
1047182675 8:122604418-122604440 TGCTCCTCTCCTCCCTCCCTAGG + Intergenic
1048855163 8:138680699-138680721 TGCTTCTTACCTTCTTCCTCCGG + Intronic
1050496190 9:6245039-6245061 AGCTACTTCCCTACTTCCCAGGG + Intronic
1051141745 9:13986600-13986622 TCCTCTTTTCCACCTTCCCACGG + Intergenic
1051627820 9:19114823-19114845 TTCTTCTTACCTCCTGCCTATGG - Intronic
1053456754 9:38238918-38238940 TGCTGCTTACCTGCTACCAAAGG + Intergenic
1058122786 9:101157071-101157093 TCCTCATTAGCTCCTTCACATGG - Intronic
1058124514 9:101176258-101176280 CCCTCCTTACCTCCTGGCCAGGG - Intronic
1058775150 9:108276000-108276022 TAGTTCTTTCCTCCTTCCCAAGG + Intergenic
1059149422 9:111935931-111935953 TGCACCTTACATACTTTCCAAGG + Intergenic
1060930577 9:127487267-127487289 TGCTCCTTGCTCCCTGCCCAGGG + Intronic
1061337464 9:129950332-129950354 TGCCACTTACCTCCTTTCCAAGG - Intronic
1062267191 9:135692581-135692603 GCCTCCTAACCTCCTGCCCACGG + Intergenic
1062431893 9:136530017-136530039 TGCCCCTTTCCTCCTTCCTGGGG - Intronic
1186532845 X:10314665-10314687 TGCTCCTTCCCTTCCTCCCCAGG - Intergenic
1186601448 X:11041943-11041965 TACTCCTTACCTACTTACAATGG - Intergenic
1187500212 X:19833143-19833165 TGGTCCTCCTCTCCTTCCCACGG + Intronic
1190465055 X:50717912-50717934 TGCTCTTTCCCTCCCTTCCAAGG + Intronic
1191841303 X:65515235-65515257 TGCTCTTTTCCTACTTCCCCAGG + Intronic
1195516571 X:105783403-105783425 TCCTACTTCCCTCCTTCCCCAGG + Intergenic
1196155323 X:112422313-112422335 TGCTGCATACCTCTTTCACAGGG - Intergenic
1198423890 X:136496614-136496636 TGCCCTTTCCATCCTTCCCACGG + Intergenic
1199996982 X:153031651-153031673 TGCTACCTCCCTCCTTCCCGAGG - Intergenic
1200064437 X:153497746-153497768 TGCTTCATTCCTCCTTCCCCAGG + Intronic
1200076714 X:153554812-153554834 TGCTCCCTGCCTTCTCCCCAAGG - Intronic
1200126059 X:153815675-153815697 TGCTTCATTCCTCCTTCCCCAGG - Intronic
1201474450 Y:14365311-14365333 TGATCCTTACCTGCTGCCCTGGG - Intergenic