ID: 963835475

View in Genome Browser
Species Human (GRCh38)
Location 3:150054431-150054453
Sequence GAGAACAAGATGAGGGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963835475_963835482 29 Left 963835475 3:150054431-150054453 CCCATAGCCCTCATCTTGTTCTC No data
Right 963835482 3:150054483-150054505 GGCTCCCCAGTCTGTAAATGTGG No data
963835475_963835479 8 Left 963835475 3:150054431-150054453 CCCATAGCCCTCATCTTGTTCTC No data
Right 963835479 3:150054462-150054484 TATGAATGACTAACTGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963835475 Original CRISPR GAGAACAAGATGAGGGCTAT GGG (reversed) Intergenic
No off target data available for this crispr