ID: 963841036

View in Genome Browser
Species Human (GRCh38)
Location 3:150106653-150106675
Sequence CAGAATGAACACTGTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963841028_963841036 30 Left 963841028 3:150106600-150106622 CCATGAATAAAAGAAACAATACC No data
Right 963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG No data
963841031_963841036 9 Left 963841031 3:150106621-150106643 CCTTAGGTACAGACGAGGTCCCT No data
Right 963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG No data
963841032_963841036 -10 Left 963841032 3:150106640-150106662 CCCTCCTTTGAATCAGAATGAAC No data
Right 963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963841036 Original CRISPR CAGAATGAACACTGTGAGGT AGG Intergenic
No off target data available for this crispr