ID: 963841659

View in Genome Browser
Species Human (GRCh38)
Location 3:150114019-150114041
Sequence GGAACTGCCACCTTCATCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963841659_963841661 -8 Left 963841659 3:150114019-150114041 CCACCGATGAAGGTGGCAGTTCC No data
Right 963841661 3:150114034-150114056 GCAGTTCCTTGCTCTTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963841659 Original CRISPR GGAACTGCCACCTTCATCGG TGG (reversed) Intergenic
No off target data available for this crispr