ID: 963841661

View in Genome Browser
Species Human (GRCh38)
Location 3:150114034-150114056
Sequence GCAGTTCCTTGCTCTTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963841656_963841661 5 Left 963841656 3:150114006-150114028 CCAGAACAACTCACCACCGATGA No data
Right 963841661 3:150114034-150114056 GCAGTTCCTTGCTCTTCAGTAGG No data
963841659_963841661 -8 Left 963841659 3:150114019-150114041 CCACCGATGAAGGTGGCAGTTCC No data
Right 963841661 3:150114034-150114056 GCAGTTCCTTGCTCTTCAGTAGG No data
963841655_963841661 20 Left 963841655 3:150113991-150114013 CCAGAGACTTAGTCTCCAGAACA No data
Right 963841661 3:150114034-150114056 GCAGTTCCTTGCTCTTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963841661 Original CRISPR GCAGTTCCTTGCTCTTCAGT AGG Intergenic
No off target data available for this crispr