ID: 963843614

View in Genome Browser
Species Human (GRCh38)
Location 3:150132755-150132777
Sequence CTGTGCAGGAAGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963843606_963843614 6 Left 963843606 3:150132726-150132748 CCCAGCTCTTACTTTTCTATTTC No data
Right 963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG No data
963843605_963843614 13 Left 963843605 3:150132719-150132741 CCTCTGACCCAGCTCTTACTTTT No data
Right 963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG No data
963843607_963843614 5 Left 963843607 3:150132727-150132749 CCAGCTCTTACTTTTCTATTTCA No data
Right 963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG No data
963843604_963843614 17 Left 963843604 3:150132715-150132737 CCTACCTCTGACCCAGCTCTTAC No data
Right 963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963843614 Original CRISPR CTGTGCAGGAAGAGGGAAGG GGG Intergenic
No off target data available for this crispr