ID: 963843927

View in Genome Browser
Species Human (GRCh38)
Location 3:150135525-150135547
Sequence GAGAACATTCTGTAGCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963843927_963843931 30 Left 963843927 3:150135525-150135547 CCAGCAGGCTACAGAATGTTCTC No data
Right 963843931 3:150135578-150135600 AAACTTGCTTTGCATTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963843927 Original CRISPR GAGAACATTCTGTAGCCTGC TGG (reversed) Intergenic
No off target data available for this crispr