ID: 963844022

View in Genome Browser
Species Human (GRCh38)
Location 3:150136705-150136727
Sequence CTGAAGTCAAAAATGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963844015_963844022 14 Left 963844015 3:150136668-150136690 CCATTTTGACAAATGCCAGATAC No data
Right 963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG No data
963844016_963844022 -1 Left 963844016 3:150136683-150136705 CCAGATACAACTACCCCAGTTGC No data
Right 963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963844022 Original CRISPR CTGAAGTCAAAAATGGAGAA GGG Intergenic
No off target data available for this crispr