ID: 963851589

View in Genome Browser
Species Human (GRCh38)
Location 3:150215661-150215683
Sequence CTTCAATGGAAGAGGGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963851589_963851593 0 Left 963851589 3:150215661-150215683 CCAGGTACCCTCTTCCATTGAAG No data
Right 963851593 3:150215684-150215706 AAAAACCCACATTCTGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963851589 Original CRISPR CTTCAATGGAAGAGGGTACC TGG (reversed) Intergenic
No off target data available for this crispr