ID: 963852217

View in Genome Browser
Species Human (GRCh38)
Location 3:150220323-150220345
Sequence GGCAAATGGCCTTGGCGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963852217_963852231 28 Left 963852217 3:150220323-150220345 CCCTAACGCCAAGGCCATTTGCC No data
Right 963852231 3:150220374-150220396 CACAGCCTCCAATGGAGGTGGGG No data
963852217_963852228 26 Left 963852217 3:150220323-150220345 CCCTAACGCCAAGGCCATTTGCC No data
Right 963852228 3:150220372-150220394 ACCACAGCCTCCAATGGAGGTGG No data
963852217_963852222 2 Left 963852217 3:150220323-150220345 CCCTAACGCCAAGGCCATTTGCC No data
Right 963852222 3:150220348-150220370 TTGTCCCTCACTGCTTCTCCTGG No data
963852217_963852226 20 Left 963852217 3:150220323-150220345 CCCTAACGCCAAGGCCATTTGCC No data
Right 963852226 3:150220366-150220388 CCTGGCACCACAGCCTCCAATGG No data
963852217_963852227 23 Left 963852217 3:150220323-150220345 CCCTAACGCCAAGGCCATTTGCC No data
Right 963852227 3:150220369-150220391 GGCACCACAGCCTCCAATGGAGG No data
963852217_963852230 27 Left 963852217 3:150220323-150220345 CCCTAACGCCAAGGCCATTTGCC No data
Right 963852230 3:150220373-150220395 CCACAGCCTCCAATGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963852217 Original CRISPR GGCAAATGGCCTTGGCGTTA GGG (reversed) Intergenic
No off target data available for this crispr