ID: 963852656

View in Genome Browser
Species Human (GRCh38)
Location 3:150223909-150223931
Sequence ATGCTTCCCTGGAAGCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963852656_963852662 18 Left 963852656 3:150223909-150223931 CCAGAAGGCTTCCAGGGAAGCAT No data
Right 963852662 3:150223950-150223972 CTGCAGCTGGAAGGCAGATCAGG No data
963852656_963852658 5 Left 963852656 3:150223909-150223931 CCAGAAGGCTTCCAGGGAAGCAT No data
Right 963852658 3:150223937-150223959 AAACCTTCATCTCCTGCAGCTGG No data
963852656_963852660 9 Left 963852656 3:150223909-150223931 CCAGAAGGCTTCCAGGGAAGCAT No data
Right 963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963852656 Original CRISPR ATGCTTCCCTGGAAGCCTTC TGG (reversed) Intergenic
No off target data available for this crispr