ID: 963852657

View in Genome Browser
Species Human (GRCh38)
Location 3:150223920-150223942
Sequence AGGTTTTTAAAATGCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963852657_963852658 -6 Left 963852657 3:150223920-150223942 CCAGGGAAGCATTTTAAAAACCT No data
Right 963852658 3:150223937-150223959 AAACCTTCATCTCCTGCAGCTGG No data
963852657_963852660 -2 Left 963852657 3:150223920-150223942 CCAGGGAAGCATTTTAAAAACCT No data
Right 963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG No data
963852657_963852664 26 Left 963852657 3:150223920-150223942 CCAGGGAAGCATTTTAAAAACCT No data
Right 963852664 3:150223969-150223991 CAGGAAAAAAAAACAGGTTCAGG No data
963852657_963852662 7 Left 963852657 3:150223920-150223942 CCAGGGAAGCATTTTAAAAACCT No data
Right 963852662 3:150223950-150223972 CTGCAGCTGGAAGGCAGATCAGG No data
963852657_963852663 20 Left 963852657 3:150223920-150223942 CCAGGGAAGCATTTTAAAAACCT No data
Right 963852663 3:150223963-150223985 GCAGATCAGGAAAAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963852657 Original CRISPR AGGTTTTTAAAATGCTTCCC TGG (reversed) Intergenic
No off target data available for this crispr