ID: 963852660

View in Genome Browser
Species Human (GRCh38)
Location 3:150223941-150223963
Sequence CTTCATCTCCTGCAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963852657_963852660 -2 Left 963852657 3:150223920-150223942 CCAGGGAAGCATTTTAAAAACCT No data
Right 963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG No data
963852656_963852660 9 Left 963852656 3:150223909-150223931 CCAGAAGGCTTCCAGGGAAGCAT No data
Right 963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963852660 Original CRISPR CTTCATCTCCTGCAGCTGGA AGG Intergenic
No off target data available for this crispr