ID: 963859794

View in Genome Browser
Species Human (GRCh38)
Location 3:150297374-150297396
Sequence TTGAGTTGGCTGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963859789_963859794 -9 Left 963859789 3:150297360-150297382 CCACGTGGCATCAGTTGAGTTGG No data
Right 963859794 3:150297374-150297396 TTGAGTTGGCTGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963859794 Original CRISPR TTGAGTTGGCTGGAGGTGGA AGG Intergenic
No off target data available for this crispr