ID: 963862851

View in Genome Browser
Species Human (GRCh38)
Location 3:150328741-150328763
Sequence CCTTTTCTATGAGCACGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963862851_963862853 -3 Left 963862851 3:150328741-150328763 CCAGTTCGTGCTCATAGAAAAGG No data
Right 963862853 3:150328761-150328783 AGGAGAACTCAGCAAGCAGCTGG No data
963862851_963862854 -2 Left 963862851 3:150328741-150328763 CCAGTTCGTGCTCATAGAAAAGG No data
Right 963862854 3:150328762-150328784 GGAGAACTCAGCAAGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963862851 Original CRISPR CCTTTTCTATGAGCACGAAC TGG (reversed) Intergenic
No off target data available for this crispr