ID: 963863613

View in Genome Browser
Species Human (GRCh38)
Location 3:150336179-150336201
Sequence GAGGATATACAGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963863613_963863627 29 Left 963863613 3:150336179-150336201 CCCACCTCCTTCTGTATATCCTC No data
Right 963863627 3:150336231-150336253 CCCTTTCTCTATCACATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963863613 Original CRISPR GAGGATATACAGAAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr