ID: 963867458

View in Genome Browser
Species Human (GRCh38)
Location 3:150378156-150378178
Sequence TTAGTTCAGAGGTTGCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963867455_963867458 -4 Left 963867455 3:150378137-150378159 CCTACTAGGCCTTTAAAACTTAG No data
Right 963867458 3:150378156-150378178 TTAGTTCAGAGGTTGCCTGTAGG No data
963867451_963867458 15 Left 963867451 3:150378118-150378140 CCTTGGCCAAAAACATTGCCCTA No data
Right 963867458 3:150378156-150378178 TTAGTTCAGAGGTTGCCTGTAGG No data
963867453_963867458 9 Left 963867453 3:150378124-150378146 CCAAAAACATTGCCCTACTAGGC No data
Right 963867458 3:150378156-150378178 TTAGTTCAGAGGTTGCCTGTAGG No data
963867454_963867458 -3 Left 963867454 3:150378136-150378158 CCCTACTAGGCCTTTAAAACTTA No data
Right 963867458 3:150378156-150378178 TTAGTTCAGAGGTTGCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963867458 Original CRISPR TTAGTTCAGAGGTTGCCTGT AGG Intergenic
No off target data available for this crispr