ID: 963870316

View in Genome Browser
Species Human (GRCh38)
Location 3:150408759-150408781
Sequence CGGGAGCCGCGGGCCGGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 3, 2: 6, 3: 61, 4: 498}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963870316_963870324 3 Left 963870316 3:150408759-150408781 CCAGCTCCGGCCCGCGGCTCCCG 0: 1
1: 3
2: 6
3: 61
4: 498
Right 963870324 3:150408785-150408807 GAATTAGGCATCTCCGACTCCGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963870316 Original CRISPR CGGGAGCCGCGGGCCGGAGC TGG (reversed) Exonic