ID: 963870316

View in Genome Browser
Species Human (GRCh38)
Location 3:150408759-150408781
Sequence CGGGAGCCGCGGGCCGGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 3, 2: 6, 3: 61, 4: 498}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963870316_963870324 3 Left 963870316 3:150408759-150408781 CCAGCTCCGGCCCGCGGCTCCCG 0: 1
1: 3
2: 6
3: 61
4: 498
Right 963870324 3:150408785-150408807 GAATTAGGCATCTCCGACTCCGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963870316 Original CRISPR CGGGAGCCGCGGGCCGGAGC TGG (reversed) Exonic
900113523 1:1019552-1019574 CGGGAGCTGCGGCGCGGAGGCGG - Intergenic
900189983 1:1349223-1349245 CGGGAGCCGGGGGCGGCGGCCGG - Intronic
900307723 1:2019267-2019289 AGGGAGCGGCGGGCTGGGGCGGG + Intergenic
902323732 1:15684744-15684766 CGGGAGCCCCGGGCCGGTAGAGG + Intronic
902375137 1:16026924-16026946 CGGGGGCGGCGGGGCGGGGCGGG + Intronic
902757535 1:18558676-18558698 CGGGCGCCGGGGGCGGGGGCGGG + Intergenic
903161303 1:21491059-21491081 CTGGAGCCCTGGGCCAGAGCAGG + Intergenic
903231820 1:21926979-21927001 CAGGAGGTGGGGGCCGGAGCCGG + Intronic
903652498 1:24930311-24930333 CGGGGCCCGCGGGGCGGGGCTGG + Intronic
903950629 1:26994074-26994096 GGGGGGCCGCGCGCTGGAGCTGG + Exonic
905215084 1:36401162-36401184 CAGGAACCACGGGCCAGAGCAGG - Intergenic
905927513 1:41762447-41762469 CTGGATCCGCAGGCTGGAGCAGG + Intronic
905986728 1:42291926-42291948 GAGGAGCCGAGGGCAGGAGCCGG + Intronic
906116092 1:43358474-43358496 GGAGAGCCGCGGGCGGCAGCGGG - Intergenic
906962232 1:50425719-50425741 CGGGATCCCCGGTCCGGAGTGGG - Intergenic
910000038 1:82330802-82330824 CCGGAGCTGCAGGCCGGAGCAGG - Intergenic
910687108 1:89928610-89928632 GGGGAGTCTGGGGCCGGAGCTGG + Intronic
912174532 1:107140414-107140436 CGGGAGCCGCTGGTGGGGGCGGG + Intronic
912174658 1:107141154-107141176 GGGGAGTGGCGGGCCGGCGCTGG + Intronic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
915165697 1:153946642-153946664 CGGCGCCCGCGGCCCGGAGCGGG - Exonic
915310579 1:155004080-155004102 GGGGAGCCTGGGTCCGGAGCAGG + Intronic
915349135 1:155213639-155213661 CGGGTGCCTGGGGCCCGAGCAGG - Exonic
915352322 1:155234266-155234288 CGGGTGCCTGGGGCCCGAGCAGG - Intergenic
915972931 1:160366901-160366923 CGGGAGCTGGGGGCGGGGGCTGG - Intergenic
916414097 1:164576639-164576661 GGGGAGCCTCGGGCCGCCGCCGG - Intronic
916744051 1:167670715-167670737 GGGGAGCCGAGGGGAGGAGCAGG - Intronic
918040685 1:180912570-180912592 CGGGGAGCGCGGGCAGGAGCTGG - Intergenic
918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG + Exonic
919929917 1:202214418-202214440 CGGGCGGCGCGGGCAGGGGCGGG + Intronic
921355564 1:214281443-214281465 CGGCGGCGGCGGGCGGGAGCCGG + Intronic
921650723 1:217674746-217674768 CTGGAGCCACAGGCCAGAGCAGG - Intronic
923631057 1:235649826-235649848 CGGGAGGCGCGGCGCGGGGCGGG - Exonic
923631162 1:235650112-235650134 CGGGGGGCGCGGGCCCGGGCTGG - Intronic
923684137 1:236142389-236142411 CGGGGCGCGCGGGCCGGGGCGGG + Intergenic
923782991 1:237042408-237042430 CGGGAGCCGGGGGCTGGAGGGGG - Exonic
924172439 1:241356756-241356778 CGGGAGCCCCGCGCCGGGGCTGG - Intronic
924198853 1:241639757-241639779 CGGGGGGCGCGGGGCCGAGCGGG + Intronic
1062843901 10:690034-690056 CGGGGCCCGCGGGGCGGGGCGGG + Intergenic
1062889645 10:1048792-1048814 GGGGAGCTGCGGGACGGGGCGGG - Intronic
1063615463 10:7596393-7596415 AGGAAGCCGTGGGCCGCAGCTGG - Intronic
1065102051 10:22340873-22340895 CGCGGGCCGCCGGCCTGAGCTGG - Intergenic
1065177808 10:23095794-23095816 CGGGAGCCTAGGGCCGGTCCAGG + Intronic
1065804030 10:29378586-29378608 CGAGAGCCGCAGGCAGAAGCAGG + Intergenic
1065844679 10:29735431-29735453 GGGGAGGAGCGGGCCGGGGCAGG - Intronic
1065883710 10:30059166-30059188 CGGGCACCGCGGGCCGCGGCTGG - Intronic
1065945145 10:30599351-30599373 CGAGAGCCGTGGGCAGAAGCAGG - Intergenic
1065993255 10:31032491-31032513 CGGGAGCCAGGGGCGGGAGCCGG - Intergenic
1067060923 10:43077522-43077544 CGGGCGCCTCGGGCCGGGGCTGG + Intronic
1067258609 10:44666687-44666709 CAGGAGCCACAGGCCAGAGCAGG - Intergenic
1069662476 10:70132676-70132698 CGGGCGCCCCGGGCGGGACCGGG - Intronic
1069846772 10:71377492-71377514 CGGGAGCCGCGGGGCAGGCCGGG + Intergenic
1070329183 10:75405659-75405681 CAGGAGCCGCGGCCCGGCCCGGG + Intergenic
1072638881 10:97196231-97196253 CCGACGCCGCGGGCCGGGGCTGG - Intronic
1072783983 10:98268224-98268246 GGGGGGCCGCGGGCGGGAGGCGG - Exonic
1073147949 10:101292600-101292622 GCGCGGCCGCGGGCCGGAGCGGG - Intergenic
1073299343 10:102461471-102461493 CGGGGCTCGCGGGCAGGAGCGGG + Intronic
1073323165 10:102627931-102627953 GGGGTGCTGCGGGCAGGAGCGGG - Intronic
1074088346 10:110225884-110225906 CGGCAGCCGCGGGCGGGTGCGGG + Intronic
1075259260 10:120949032-120949054 AGGGAGCCGCGGCCCCGAGCTGG + Intergenic
1075885624 10:125896659-125896681 AGGGAGGCCCGGGCTGGAGCTGG + Intronic
1076035632 10:127196591-127196613 CGGGCCCCGCGGGGCGGAGGTGG + Intronic
1076371796 10:129960056-129960078 CGGGAGCCGCCCGCCCGGGCTGG + Intronic
1076374241 10:129972844-129972866 TGGGGGCCGCGGGCTGGGGCGGG + Intergenic
1076554102 10:131311202-131311224 CGCGAGCCGGAGGCCAGAGCCGG + Intronic
1076728090 10:132422545-132422567 TGGGGGCTGCGGGCTGGAGCGGG - Intergenic
1077097173 11:803981-804003 CGGGAGGGGCGGCCTGGAGCTGG + Intronic
1077105840 11:842356-842378 CGTGGGGCGCGGGCCGGGGCTGG - Intronic
1077214627 11:1390251-1390273 CGGGCGCCCCTGGCCGGCGCCGG + Intronic
1077247637 11:1547218-1547240 CGCGCGCCGCGGGGCGCAGCCGG - Intergenic
1077277502 11:1721068-1721090 CGGGAGGCGCAGGGCAGAGCCGG + Intergenic
1077353295 11:2102923-2102945 AGGGAGCTGGGGGCTGGAGCAGG + Intergenic
1080485804 11:32705154-32705176 CAGGAGCCGCGGGCTGAAGCAGG + Intronic
1080727887 11:34916155-34916177 CGGGACCCGGCGGCTGGAGCTGG - Intronic
1081831602 11:46120386-46120408 CGGGGGCTGCGGGCGGGGGCGGG - Intronic
1081845512 11:46238072-46238094 CGGGCCCCGGGGCCCGGAGCGGG + Intergenic
1081860991 11:46333246-46333268 CAGGAGCCGCGGGCGGAAGGCGG + Intronic
1081870720 11:46381539-46381561 CGGGGGGCGCGGGCTGGAGCGGG + Intronic
1082022472 11:47546257-47546279 CGGGGGCCGGGGGCGGGGGCGGG + Intronic
1083648460 11:64186419-64186441 CGCGGGCGGCGGGCGGGAGCGGG + Intronic
1083657040 11:64234718-64234740 CGGGCGCGGCGGGCGGGGGCCGG - Exonic
1083686641 11:64380488-64380510 GGGGAGCCGCGGGCAGGCACGGG + Intergenic
1083799984 11:65041186-65041208 GGGGAGCGGCGGGTCGGGGCGGG - Exonic
1084165583 11:67373421-67373443 CGGGAGCCCCGCGCCGGGGCCGG - Intronic
1084315532 11:68343292-68343314 GGGGACTCTCGGGCCGGAGCTGG + Intronic
1084386268 11:68844256-68844278 CGGGAGCCGCAGACCCGGGCAGG - Intronic
1084642470 11:70434103-70434125 CGGGAGCTGGCGGCCGGGGCAGG - Intronic
1084749289 11:71193641-71193663 CAGGTGCCCAGGGCCGGAGCAGG - Intronic
1084758378 11:71252733-71252755 CCGCAGCCGCGGGCGGGAGCGGG - Intergenic
1085507101 11:77066897-77066919 CGGGCGGGGCGGGGCGGAGCCGG + Intergenic
1088972606 11:114787040-114787062 AGGGAGCTGCGGGCGGCAGCAGG - Intergenic
1089954434 11:122556809-122556831 TGGGAGGCGCGAGCGGGAGCCGG + Intergenic
1090003647 11:122981937-122981959 CGGGAGGCTCGGGGCGGGGCGGG + Intergenic
1091550093 12:1530411-1530433 CGGGTCCCGCGCTCCGGAGCAGG + Intronic
1091616195 12:2052906-2052928 CGGGCGGCGCGGGCAGGGGCGGG + Intronic
1091677931 12:2504768-2504790 CGGGAGCCGGGGACCGGCACTGG + Intronic
1091759412 12:3077295-3077317 GGGGAGGGGCGGGGCGGAGCGGG - Intergenic
1091969195 12:4771743-4771765 CGGGAGCAGAGGGCAGGACCAGG + Intronic
1092843318 12:12562877-12562899 CGGGCGCCGCTGGGAGGAGCCGG + Intergenic
1094048763 12:26196148-26196170 TGGGAGCCGCGAGCAGGAGAGGG - Intronic
1096105426 12:48994815-48994837 CGGGGGCTGGGGGCCGGGGCAGG + Intergenic
1096240092 12:49955340-49955362 CGGGCTCCGCGTGCCGGTGCCGG + Intronic
1096466190 12:51848693-51848715 CGGCCGCCGCGGGCGGGAGCGGG + Intergenic
1096749844 12:53751729-53751751 CGGAAGCCGCGGCCCCGGGCGGG - Intergenic
1096796739 12:54082567-54082589 CCGGGGCCGGGGGCCGGGGCCGG + Intergenic
1098425950 12:70366180-70366202 CGGGCGGGGCGGGGCGGAGCGGG + Intergenic
1099640389 12:85278500-85278522 CGGGATCCGCCGGTCGGATCTGG + Intergenic
1100078884 12:90824062-90824084 GGAGAGGCGCGGGCGGGAGCCGG + Intergenic
1100260492 12:92928792-92928814 ACGGAGCCCCGCGCCGGAGCGGG + Intronic
1101504168 12:105330948-105330970 CGGGAGGCGGGGGCCGGCGGGGG + Intronic
1102853895 12:116277308-116277330 CGGGGGCAGCGGGCCCGGGCTGG + Exonic
1103509713 12:121466564-121466586 TGCGAGCCGCGGGCCGGCGCGGG - Intronic
1103595523 12:122022475-122022497 CGGGAGCCGAGCGCCGCGGCGGG - Intronic
1103699192 12:122839890-122839912 CGGTAGCCGCTGGCCGGTGCGGG - Intronic
1103800381 12:123533829-123533851 CGGGCGCCTCGGGGCGGTGCGGG + Intergenic
1103944254 12:124517515-124517537 GGGGAGCCGGGCGCCGGGGCCGG + Intronic
1104049631 12:125186729-125186751 CGGGAGCCGCGGGCCGGGCCGGG + Intergenic
1104709383 12:130974806-130974828 CGGGAGCGGGGGTCCGGAGCAGG - Intronic
1104854315 12:131894919-131894941 GCGGAGGCGCGGGCCGGGGCGGG - Exonic
1105031409 12:132887159-132887181 CCGGGGCCGGGGGCCGGGGCCGG - Intronic
1105472144 13:20703912-20703934 CGGGCGCCGCGGGCGGGACACGG + Intronic
1105804613 13:23945904-23945926 CGGGAGCCGCGGGGGCGAGATGG - Intergenic
1106241949 13:27920072-27920094 CGGGAGTCGGGAGCTGGAGCCGG - Exonic
1106248364 13:27966908-27966930 CGCAGCCCGCGGGCCGGAGCCGG - Intronic
1106303857 13:28494102-28494124 CGAGAGCGGCGGGGAGGAGCGGG + Intronic
1106510482 13:30408541-30408563 GGGGCGCCGAGAGCCGGAGCGGG + Intergenic
1106614110 13:31310611-31310633 CAGGAGCCACGGGCTGGAGTGGG + Intronic
1110219670 13:73059548-73059570 AGGCAGCCGCGGGCCGGTGGCGG - Exonic
1111091594 13:83453510-83453532 CAGGAGCCATGGGCCAGAGCTGG + Intergenic
1111232570 13:85363151-85363173 TGGGAGGCGCGGGCGGGAGCCGG + Intergenic
1113874303 13:113584912-113584934 CGGGAGCCGCGGGCGGGAGCCGG + Intronic
1114187372 14:20413213-20413235 CCGGAGCCGCCGGGAGGAGCAGG + Intronic
1114674217 14:24430157-24430179 CGGGGGCCGCGGTGCGGAGTAGG + Intronic
1115243310 14:31270423-31270445 CTGGAGCCAAGGGCCAGAGCTGG + Intergenic
1115320674 14:32076854-32076876 CGGGAGACGAGGGCAGGGGCGGG + Intronic
1117424616 14:55580812-55580834 CGGCGTCCCCGGGCCGGAGCTGG + Intronic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1119731954 14:76956674-76956696 CGCCCGCCGCGGGCCGGGGCTGG + Intergenic
1120905682 14:89619160-89619182 CGGGCGCCGGGCGCAGGAGCCGG - Intergenic
1121546954 14:94769786-94769808 CGGGAGCCGCTGACCGCGGCCGG + Exonic
1122532479 14:102438222-102438244 CGGGAGCAGGGAGCGGGAGCAGG - Intronic
1122532483 14:102438235-102438257 CAGGAGCGGCGAGCGGGAGCAGG - Intronic
1122550016 14:102544636-102544658 CGGGGGCCGGGGGCCGCGGCGGG + Intergenic
1122861370 14:104584104-104584126 CGAGAGCTGCTGGCAGGAGCTGG + Intronic
1122975181 14:105168134-105168156 AGGGAGGCGCGGGCCGGGGTCGG + Intronic
1123004373 14:105314435-105314457 CGGGAGCCGCGGGCAAGGGCCGG - Exonic
1123104964 14:105837008-105837030 GGGGAGCCGGGGGCAGGGGCTGG + Intergenic
1202926667 14_KI270724v1_random:31780-31802 CGGGAGCAGCTGGGCAGAGCGGG + Intergenic
1123684302 15:22786566-22786588 CGGGAGGCGCGGGCGGGGGAGGG - Intronic
1124129390 15:26971210-26971232 CTGGAGCCGCGAGCGGGCGCGGG - Intergenic
1124340316 15:28886025-28886047 CGGCAGCCGCAGGCCGGTGCGGG + Exonic
1124973671 15:34514516-34514538 CGGCAGTCCCGGGCCGGGGCTGG + Intergenic
1125516316 15:40323310-40323332 TCGGAGCCTCGGGGCGGAGCGGG + Intergenic
1125577900 15:40767617-40767639 CAGCTGCCCCGGGCCGGAGCTGG + Exonic
1125918585 15:43510844-43510866 CCGCAGGGGCGGGCCGGAGCTGG - Intergenic
1126109419 15:45166958-45166980 CGGAAGCCGCGCGCCGGCGGAGG - Intergenic
1126134628 15:45378405-45378427 CGGGAGCCGCGGCGCCGAGGCGG - Exonic
1126777607 15:52112808-52112830 CGGGGGCCGGGGGCCGGGGCGGG - Intergenic
1127674835 15:61228996-61229018 CGGGAGCCCGGGCGCGGAGCGGG - Intronic
1127753625 15:62068648-62068670 CGAGGGCCGCGGCCGGGAGCGGG + Exonic
1127877240 15:63121994-63122016 CGGGGGCCTCGGGCTGGGGCTGG + Exonic
1128181707 15:65610931-65610953 CGGGAGCAGCGCCCCGGAACTGG + Intronic
1128506646 15:68277733-68277755 CGGGAGGAGAGGGCGGGAGCGGG - Intergenic
1129196899 15:73973748-73973770 GGAGAGCCGCGGGCGGGAACCGG + Intergenic
1129539107 15:76336708-76336730 CACTAGCCCCGGGCCGGAGCTGG - Exonic
1129644622 15:77419501-77419523 CGGCAGCGTCGGGACGGAGCCGG - Intronic
1129724427 15:77894333-77894355 GGAGAGGCGCGGGCCGGAACCGG - Intergenic
1131146553 15:90017564-90017586 CGGGATCTGTGGGCCTGAGCTGG + Intronic
1131160678 15:90102687-90102709 CGGGACCCGCGAGCGGGATCAGG + Intergenic
1131257619 15:90872205-90872227 CGGGCGCCGGCGGCCGGCGCAGG + Intronic
1131696492 15:94882524-94882546 CAGGAGCTGTGGGCCAGAGCTGG - Intergenic
1132146946 15:99434835-99434857 CGGGAGCCCCGGGCTGGTGGGGG - Intergenic
1132589684 16:721214-721236 CGAGGGCCGCGGACCCGAGCCGG + Exonic
1132630700 16:915859-915881 TGGGACGCGGGGGCCGGAGCAGG + Intronic
1132652489 16:1027945-1027967 GGGGCCCCGCTGGCCGGAGCAGG + Intergenic
1132763111 16:1520568-1520590 AGGTAGCCGCGGGCTGGGGCCGG + Intronic
1132891492 16:2207018-2207040 CGGGACCTGCGGGCCGGGCCGGG - Exonic
1133129952 16:3670875-3670897 CCTGTGCCGCGGGCAGGAGCAGG - Intronic
1133259426 16:4538560-4538582 CAGGCGCCGCGGGCGGGGGCGGG + Intronic
1134290823 16:12901950-12901972 CGGGAGCTGCGAGCCGCCGCGGG - Exonic
1135016079 16:18926122-18926144 CCTCAGCCCCGGGCCGGAGCGGG - Exonic
1135115184 16:19718002-19718024 CGGCGGCCTCAGGCCGGAGCGGG + Exonic
1135437263 16:22437298-22437320 CCTCAGCCCCGGGCCGGAGCGGG + Intergenic
1136333169 16:29595047-29595069 CCTCAGCCCCGGGCCGGAGCGGG - Intergenic
1136447863 16:30335113-30335135 CCTCAGCCCCGGGCCGGAGCGGG - Intergenic
1137426337 16:48384712-48384734 CGGGCGCCGCGGGGAGGAGGGGG + Intronic
1137731482 16:50693611-50693633 CGGGAGTCGTGGCCCGGAGTGGG + Intronic
1138651539 16:58463981-58464003 CGGGAGCCGCGGGGAGGAGGGGG - Intronic
1138689487 16:58754057-58754079 CCCGAGCTGCTGGCCGGAGCAGG - Intergenic
1138998325 16:62478741-62478763 CAGGAGCTGCAGGCTGGAGCAGG + Intergenic
1139088555 16:63617495-63617517 AGGGAGGCGCGGGCGGGAGGCGG - Intergenic
1139390628 16:66604839-66604861 CGGGAGCCGCCGGCAGGCTCGGG - Exonic
1139390779 16:66605298-66605320 CGGGACTCCCGGGCCGCAGCGGG + Intronic
1139403051 16:66696961-66696983 CGGGAGCCGCTGGTGGGCGCTGG + Intergenic
1139896234 16:70289758-70289780 CGGGAGCCGGGGGCGGGGGGGGG - Intronic
1141563086 16:84883311-84883333 CGGGAGCCGCAGGCAGGAACAGG - Intronic
1141630796 16:85286972-85286994 CGGGGGCCGCGGGCTCCAGCGGG + Intergenic
1141658337 16:85428234-85428256 CAGGAGCCCAGGGCCGGGGCTGG - Intergenic
1141830847 16:86509489-86509511 CGGGCGCCGCGGGCCTGACGGGG - Intergenic
1141972288 16:87492332-87492354 GGGGACGCGCGGGCCGGGGCCGG + Intergenic
1142302273 16:89265665-89265687 CGGGAGTCTCTGGCTGGAGCTGG - Intergenic
1142876158 17:2853237-2853259 CGGGAGCTGCGAGCCGGGGCGGG + Intronic
1143416810 17:6756519-6756541 AGGGAGCCGTGGGGCGGGGCAGG + Intronic
1143639879 17:8189846-8189868 CGGGAGCCGCAGGGGGGCGCCGG - Exonic
1143747233 17:9003465-9003487 CCGGGGTCGCGGCCCGGAGCAGG - Intergenic
1144775309 17:17782165-17782187 CGGGGGCCGCGGGCCAGGGGAGG + Intronic
1145243517 17:21253036-21253058 CCCGGGCGGCGGGCCGGAGCCGG + Intronic
1146283314 17:31559097-31559119 CCGGTGCCGCAGGCTGGAGCGGG + Intergenic
1147139678 17:38454013-38454035 CGGGGGCCGGGGGCTGGCGCTGG + Intronic
1147184268 17:38705229-38705251 CGGGTGGCGCGGGGCGGCGCGGG + Intergenic
1147392987 17:40121838-40121860 CGGGGGCCGGGGGCCGGCGAGGG - Intergenic
1147967229 17:44199783-44199805 CGGGAGAGGCGGGCTGGAGTGGG - Intronic
1148128306 17:45247942-45247964 CGGAAGCCGGGGCCCGGGGCTGG + Intergenic
1149712498 17:58756075-58756097 CGGCGGCGGCGAGCCGGAGCCGG + Exonic
1150060619 17:62065437-62065459 CCGGGGCCGAGGGCCGGAGGCGG + Intergenic
1150108702 17:62479396-62479418 CAGGAGCTGCGGTCCGGAGCCGG - Intronic
1150249930 17:63699778-63699800 CGGGGGCCGAGGGGCGGGGCGGG - Intronic
1150737219 17:67751210-67751232 CTGGAGCCTTGGGCCAGAGCAGG + Intergenic
1151408041 17:73902220-73902242 CGGGACCAGCAGGGCGGAGCGGG - Intergenic
1151767648 17:76140469-76140491 CGGGAGCTGCGGGACTCAGCGGG - Exonic
1151783896 17:76265799-76265821 CGGGGGCCGCGGGCCGGGCGCGG + Intronic
1152069801 17:78128834-78128856 GGGGCGCCGCGGGCCGGGCCGGG - Intronic
1152362560 17:79839403-79839425 CGCGAGCCGGGAGCCGGGGCGGG - Exonic
1152383193 17:79952782-79952804 CGGGAACCGCAGGCCGGCGTCGG + Exonic
1152392344 17:80010319-80010341 CGGGAGCCGCGGCCCGAGGCCGG - Exonic
1152628131 17:81397590-81397612 CGGGAGGCGCCGGCCGGGGCTGG + Intronic
1152823756 17:82450641-82450663 CGGGACGCGCGGCACGGAGCGGG + Exonic
1153900693 18:9614703-9614725 CGGGAGCCGCGCGGAGGGGCAGG - Intronic
1158579675 18:58671069-58671091 CGGGGACTGCGGGCGGGAGCCGG + Intergenic
1160204662 18:76822752-76822774 CGGGAGCGGCGGGGCGGGGGCGG + Intronic
1160322178 18:77905956-77905978 CAGGTGCCACGGGCGGGAGCTGG + Intergenic
1160499537 18:79395377-79395399 CGGGGGCCGGGGGCCGGGGAGGG - Intergenic
1160512115 18:79458473-79458495 CAGGACCCGCCGCCCGGAGCCGG - Intronic
1160544035 18:79641084-79641106 GGGGTGCCGGGGGCCGGGGCAGG - Intergenic
1160631232 18:80247476-80247498 CCGGTGCTGCGGGCCCGAGCTGG + Exonic
1160768842 19:821567-821589 CGGGCGCCGCAGGCCGTGGCTGG + Exonic
1160772078 19:836771-836793 CGGGGCCCGCGGGACGGTGCTGG + Intergenic
1160793651 19:934139-934161 CTGGAGGGGCGGGCAGGAGCCGG + Intronic
1160823020 19:1067113-1067135 CGGGGGGCGCGGCCCGGGGCTGG + Intronic
1160903101 19:1438906-1438928 CGGGGGTCGCGGGCAGGGGCTGG + Intronic
1161001199 19:1912143-1912165 CGGGAGCCCGGAGCCTGAGCCGG + Exonic
1161090994 19:2360105-2360127 CGGCACCCCCGGCCCGGAGCAGG + Intergenic
1161210449 19:3062663-3062685 CGGGGGCCGCTGCCCGGGGCGGG - Intronic
1161443314 19:4304706-4304728 CGGGGCCCGCGGGCCGGGCCGGG + Exonic
1161473401 19:4472471-4472493 CGGGGGCCCCGGGCCGGAGGCGG + Intronic
1161959548 19:7516194-7516216 GGGGAGCCGGCGGCCGGCGCGGG + Exonic
1162013223 19:7830413-7830435 ACGGAGCCGCCGGCCTGAGCAGG - Intronic
1162046848 19:8005644-8005666 TCCGGGCCGCGGGCCGGAGCGGG - Intronic
1162413095 19:10517994-10518016 CCTGAGCCGGGGGCGGGAGCGGG - Intergenic
1162706060 19:12555601-12555623 CGGGAGCGGCGGGCGGGAAGCGG + Intronic
1162778601 19:12995413-12995435 CGGGCGGCGCGGGCGGGAGGAGG - Intergenic
1162932039 19:13962258-13962280 CCTGAGCCCCGGGCCGGCGCAGG - Exonic
1162954121 19:14089112-14089134 CGGGTGCCGCTGCCCGGGGCTGG + Exonic
1163666586 19:18606547-18606569 GGGGCGCCGCGAGCCGGATCAGG - Exonic
1164643847 19:29844491-29844513 GGGGAGACGCGGGGCGGGGCGGG - Intergenic
1164713422 19:30375237-30375259 TGGCAGCCGCGGGCCGGCGGGGG - Intronic
1165204612 19:34172821-34172843 AGGAGGCCGCGGGCCGGAGCGGG - Intronic
1165428339 19:35757595-35757617 CGGGGGCCGCGCGCTGGGGCTGG + Intronic
1166084688 19:40467080-40467102 CGGGGACCGCGGGCGGGAGGGGG + Intronic
1166329534 19:42070072-42070094 CTGGAGCCGGGGACTGGAGCCGG - Intronic
1166361639 19:42255025-42255047 CGGGAGCCGCGGCCCGGAATCGG - Exonic
1166858028 19:45792816-45792838 CGGAAGCCGCTGGCCCGCGCCGG + Intergenic
1167437194 19:49486345-49486367 CTGGAGCCCCGGGCCGGCGCTGG + Intergenic
1167615587 19:50531148-50531170 CGGGAGCTGCAGGCAGGAGGTGG - Intronic
1167738870 19:51312138-51312160 CGGCGTCCTCGGGCCGGAGCCGG + Intronic
1167792660 19:51691033-51691055 GGGGAGGCGGGGGCCGGAGACGG - Intergenic
1168078487 19:53992921-53992943 GGGGGGCCGCGGGCCGGCGGCGG + Exonic
1168258587 19:55180240-55180262 GGGGAGCCGCGGAGCGGAGCAGG + Exonic
1168354960 19:55695179-55695201 CGGGAGGCGCGGGCTGGAAGGGG - Exonic
925070973 2:965942-965964 CGGGAGCAGCCGGGAGGAGCTGG - Intronic
925931790 2:8714115-8714137 GAGGAGCCGAAGGCCGGAGCAGG - Intergenic
926089873 2:10043192-10043214 CGGGGGCGGCGGGGCGGAGGGGG - Intronic
926095789 2:10080106-10080128 CGGGACCCGCCGGCGGGTGCCGG - Exonic
926130929 2:10302832-10302854 CCGGAGGCGGGGGCCGGGGCGGG - Intergenic
926155026 2:10448687-10448709 CAGCTGCCGCGGGCCGGGGCCGG - Intergenic
926250954 2:11155305-11155327 CGGGAGGGGCGGGGCGGGGCGGG + Intronic
927137381 2:20106865-20106887 GGAGAGGCGCGGGCGGGAGCCGG - Intergenic
927794136 2:26033787-26033809 CGGGAGGCGGGGGTCGGAGGGGG + Intergenic
927809623 2:26173854-26173876 CGGGAGAGGCCGGCGGGAGCCGG + Intronic
927843209 2:26458011-26458033 GGGGAGCGGCTGGCGGGAGCTGG + Exonic
928314002 2:30232185-30232207 CGGCAGCAGCGGGGCTGAGCTGG + Intronic
929780732 2:44955380-44955402 CGGGAGCGGTGGGTAGGAGCAGG + Intergenic
931671766 2:64654000-64654022 GGGGAGAGGCGGGCCGGGGCGGG - Intronic
932873291 2:75425343-75425365 CTGGAGCCATGAGCCGGAGCAGG - Intergenic
934085089 2:88503138-88503160 GGAGAGGCGCGGGCCGGAACCGG + Intergenic
934761260 2:96858264-96858286 CGGGAGCCGCGCGCCGCTGGAGG + Intergenic
934933152 2:98444928-98444950 CGGGCTCCGTGGGCCGGGGCAGG + Exonic
934978347 2:98821932-98821954 CGGGGGGCGCGGGCTGGTGCGGG + Exonic
935645334 2:105329677-105329699 CAGGAGCCGCGGGCCGGAGCGGG - Exonic
935692628 2:105744915-105744937 CCGGAGCCGCGCGGCCGAGCGGG + Exonic
935971570 2:108534621-108534643 CGGGAGCTGCGGGGCGGACGTGG - Intronic
936159330 2:110071902-110071924 CGGGAGCCGCCAGCATGAGCCGG + Intergenic
936185331 2:110299430-110299452 CGGGAGCCGCCAGCATGAGCCGG - Intergenic
937119422 2:119431654-119431676 GGGGAGCCGCGGGGAGGACCCGG - Intronic
937716280 2:125037335-125037357 GGAGAGGCGCGGGCGGGAGCTGG + Intergenic
938368795 2:130756155-130756177 CGGGAGGGGCGGGCCGGCGCTGG - Intronic
938406328 2:131035112-131035134 CGGGCGCCGCGGGGCCGCGCCGG - Intronic
938512581 2:131966438-131966460 AGAGAGGCGCGGGCAGGAGCTGG + Intergenic
938924205 2:136024375-136024397 CGCCATCCGCAGGCCGGAGCAGG - Intergenic
938931236 2:136088383-136088405 GGAGAGGCGCGGGCGGGAGCAGG - Intergenic
939990886 2:148875935-148875957 CGGGAGCGGCGGGCCGGGCGGGG + Intronic
940453797 2:153872116-153872138 AGAGAGGCGCGGGCGGGAGCCGG + Exonic
940640745 2:156342360-156342382 CGGGGGCCGGGGGCCGGGGGAGG - Intergenic
941929967 2:170929425-170929447 GGGGAGCTGCGGGCTGGAGGCGG + Intronic
946235753 2:218323492-218323514 TGGGAGGCGGGGGCTGGAGCTGG + Intronic
946306485 2:218859624-218859646 CGGGAGCGGGGTGCCGGGGCGGG - Intergenic
946339994 2:219060639-219060661 CGGGGGCCCAGGGCCCGAGCTGG + Intergenic
946865519 2:224038840-224038862 CGGGAGCCCCGAGCGGGACCCGG - Intronic
947641641 2:231710471-231710493 CGGGGTCCGCGGAGCGGAGCGGG + Intronic
947800829 2:232927851-232927873 CGGGGGCGGCGCGCCGGGGCCGG + Intronic
948438109 2:237967335-237967357 CGCGAGCCGGGGGTCGGAGGCGG + Intronic
948828687 2:240586812-240586834 CGGGCGGGGCGGGCCGGAGGCGG + Exonic
949027832 2:241774644-241774666 CGGGAGCAGCGGGGAGCAGCCGG - Intergenic
949027846 2:241774686-241774708 CGGGAGCAGCGGGGAGCAGCCGG - Intergenic
1169832453 20:9839134-9839156 CAGGAGCCGGGAGCTGGAGCAGG + Intergenic
1170813001 20:19689413-19689435 CTGAAGCCAGGGGCCGGAGCTGG - Intronic
1171781916 20:29427463-29427485 CGGGTGCAGCCGGGCGGAGCGGG - Intergenic
1172005413 20:31815991-31816013 AGGGAGCAGCTGGCTGGAGCAGG + Intergenic
1172146713 20:32762644-32762666 GCGGAGCCGCGGGTCGGGGCTGG - Exonic
1172245638 20:33443562-33443584 CTGGAGCTGCGCGCCGGGGCGGG - Exonic
1172277336 20:33686677-33686699 CGGGAGCGTCGGGGCGGGGCGGG - Intergenic
1172284670 20:33732211-33732233 CGGGAGCCGAGGCCCGGCGGGGG + Intronic
1172618695 20:36306382-36306404 GGGCGCCCGCGGGCCGGAGCCGG + Exonic
1173740193 20:45394849-45394871 CAGGAGCCACAGGCCGGAGCAGG + Intronic
1174060909 20:47832540-47832562 CTGGAGACCCGGGGCGGAGCTGG - Intergenic
1174070989 20:47898830-47898852 CTGGAGACCCGGGGCGGAGCTGG + Intergenic
1174153069 20:48499828-48499850 CTGGAGACCCGGGGCGGAGCTGG - Intergenic
1174362684 20:50038775-50038797 AGGGAGCTGAGGGCTGGAGCAGG + Intergenic
1174542931 20:51303983-51304005 CCGGAGCTGTGGGCTGGAGCGGG - Intergenic
1175971366 20:62688273-62688295 GGGGGGCCGCGGGCAGGACCTGG - Intergenic
1176048073 20:63102860-63102882 CGGGAGCTGCGGGCCGCTCCGGG + Intergenic
1176061609 20:63175160-63175182 CGGGAACCGGGAGCCCGAGCTGG + Intergenic
1176196041 20:63836647-63836669 TGGGAGCTGCAGGGCGGAGCTGG + Intergenic
1176390162 21:6159091-6159113 CGGGAGGCCCGGGCCGGTCCTGG + Intergenic
1179733304 21:43379149-43379171 CGGGAGGCCCGGGCCGGTCCTGG - Intergenic
1179996377 21:44976268-44976290 CGAGAGCCGAGAGCCTGAGCCGG - Intronic
1180032982 21:45224664-45224686 CGGGAGCCCTGGGCCGGGGCAGG + Exonic
1180258383 21:46649756-46649778 GGGCAGCTGGGGGCCGGAGCTGG + Intronic
1180649991 22:17369611-17369633 CAGGAGCCGAGGGCGGGCGCCGG - Exonic
1180736818 22:18023750-18023772 CGCGCGCCGCGGGCGGGTGCAGG + Intronic
1181006583 22:20016528-20016550 CTGGGGCCTCGGGTCGGAGCCGG - Intronic
1181162173 22:20965482-20965504 CGGGGGCAACGGGACGGAGCCGG + Intronic
1181235463 22:21445609-21445631 CGGGGGCTGCGAGCAGGAGCTGG + Exonic
1181269851 22:21652612-21652634 CTGGAGCCGCGGGCCGAGTCAGG + Intronic
1182903983 22:33920841-33920863 CGGGCGCCGCTGGCCGGAGCCGG + Intronic
1183393762 22:37560444-37560466 CGGGCTCCGCGGGCTGGATCCGG - Exonic
1183517048 22:38272761-38272783 CGGGAGCCGGCGGCCGAAGCCGG + Intronic
1183546294 22:38456053-38456075 CGGGGCCCGCGGCGCGGAGCAGG + Intergenic
1185317635 22:50185887-50185909 CTGGGGCCGCGGGGCGGGGCGGG - Intergenic
950069585 3:10141789-10141811 CGGGATCCGCGGGTCGGACGCGG - Exonic
951509602 3:23486540-23486562 CAGGAGCCATGGGCCGGAGCAGG - Intronic
952383457 3:32821762-32821784 CGGGACCCGCGGCACGCAGCGGG - Intronic
952644520 3:35639445-35639467 CCGGAGCTGCGGGGAGGAGCCGG + Intronic
952706194 3:36380407-36380429 CGGGCGCGGCGGGGCGGGGCAGG + Exonic
954558774 3:51538757-51538779 CGGGCGCCGCGGGCTGGCTCTGG - Intergenic
954808310 3:53232795-53232817 CTGGAGCAGGTGGCCGGAGCTGG + Intronic
956761227 3:72446962-72446984 GGGGAGCCGCGGGCCGGATCTGG + Intergenic
956798803 3:72738893-72738915 CGGGCGTCGCGGGGCGGGGCGGG - Intergenic
959049700 3:101513016-101513038 CGGGAGGCGCAGGCGGCAGCTGG - Intronic
959484692 3:106913396-106913418 CAGGAGATGCGGGCTGGAGCGGG + Intergenic
959847973 3:111056384-111056406 TGGGAGCTGCCGACCGGAGCTGG - Intergenic
961028917 3:123585122-123585144 CCAGGGCCGCGGGGCGGAGCCGG + Exonic
961182381 3:124887044-124887066 CGGGGGCCGGCGGCCGGGGCTGG + Exonic
962265503 3:133941696-133941718 AGGGAGCCGCTGGCCAGAGCTGG - Intronic
962301849 3:134250496-134250518 CGGGGGCCGCGGGGCGGGGGCGG + Exonic
962763743 3:138542522-138542544 CAGGAGCCACTGGCCAGAGCAGG - Intronic
963066186 3:141266313-141266335 CGGGGACCGCTGGCAGGAGCCGG + Intronic
963335751 3:143972147-143972169 GGGAAGGCGCGGGCCTGAGCGGG - Exonic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
965615126 3:170585613-170585635 CGGGAGCTGCCGGGCGGGGCGGG - Intronic
966182027 3:177197049-177197071 CGGGGGGCGCGGGCCAGAGGCGG - Intronic
967098075 3:186193788-186193810 GGGGCCGCGCGGGCCGGAGCAGG - Intronic
967493657 3:190120434-190120456 CGGGGGGCGGGGGCGGGAGCGGG + Exonic
968092970 3:195909595-195909617 CGGGAGGGGAGGGCCGGGGCGGG - Intronic
968114806 3:196081607-196081629 CCGGACCCGCAGCCCGGAGCCGG + Intronic
968506531 4:973591-973613 CGCGGGCCGCGGGGCGGGGCGGG + Intronic
968545188 4:1194619-1194641 CAGGTCCCGCGGGCCAGAGCAGG - Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968583157 4:1404125-1404147 CGGGTGCTGCGGGCCGGGCCCGG + Intronic
968657905 4:1786554-1786576 CGGGAGGCTGGGGCCAGAGCAGG + Intergenic
968660025 4:1795002-1795024 CGGGCGCGGCGGGCCGGGGAGGG + Intronic
968831352 4:2934322-2934344 CGCGGGGCGCGGGCCGGGGCTGG - Exonic
969138753 4:5051500-5051522 CGGGAGACGCGAGGCGGCGCGGG - Exonic
969394272 4:6910258-6910280 CGGGAGCCTCGCGTCGGAGTAGG - Intronic
969683609 4:8656808-8656830 AGGGAGCCCCAGGCAGGAGCAGG + Intergenic
969721291 4:8894210-8894232 CGGGAGCGCAGGGCCGGGGCGGG - Intergenic
971860089 4:32090747-32090769 CAGGAGCTGCAGGCTGGAGCAGG - Intergenic
972437126 4:39045011-39045033 GGGGAGGCGGGGGCCGGGGCCGG - Intergenic
974047347 4:56908612-56908634 GGAGGGCCGCGGGCCGGCGCGGG - Intronic
975002764 4:69245266-69245288 TGGGAGCTGCAGACCGGAGCTGG + Intergenic
975010868 4:69349253-69349275 TGGGAGCTGCAGACCGGAGCTGG + Intronic
978515016 4:109560311-109560333 CGGGAGCCGCGCGCCTGGGGCGG + Exonic
978944771 4:114482041-114482063 GGAGAGGCGCGGGCAGGAGCCGG - Intergenic
979136672 4:117118772-117118794 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
979780912 4:124650744-124650766 GGAGAGACGCGGGCAGGAGCTGG + Intergenic
980481610 4:133395167-133395189 CTGGAGCCACGGGCTGGAGAGGG + Intergenic
982288797 4:153759948-153759970 CGGGAGCCGAGGGTGAGAGCCGG + Exonic
982494814 4:156077571-156077593 CAGGAGCCACAGGCCGGAGTGGG - Intergenic
983352023 4:166602215-166602237 CCAGAGCCGTGGGCCAGAGCAGG + Intergenic
985068357 4:186144734-186144756 CCGGGGCCGGGGCCCGGAGCGGG + Intronic
985702220 5:1380505-1380527 GGAGAGGCGCGGGCGGGAGCGGG - Intergenic
985896392 5:2751919-2751941 CGCGAGCCGCGGGCTGGGGCCGG - Intergenic
987050211 5:14142907-14142929 GGGGTGACGCGGGCCGGGGCGGG - Intergenic
989592206 5:43121795-43121817 CGGGAGACGCGAGCTAGAGCGGG - Exonic
990512186 5:56499017-56499039 AGGGAGACGCGGGCGGGAACTGG - Intergenic
991298179 5:65103060-65103082 CGGTCGCCCCGGGCCCGAGCGGG + Intergenic
992939943 5:81751507-81751529 CTGGAGTCTCCGGCCGGAGCCGG + Intronic
994948178 5:106423313-106423335 CAGGAGCCACTGGCCAGAGCAGG + Intergenic
997297462 5:132777056-132777078 CGGGAGGCGCGGGGCGCAGGAGG - Intronic
997582977 5:135028740-135028762 CGCGGGCCGGCGGCCGGAGCGGG - Exonic
998018840 5:138753370-138753392 CGGGGGCCGCGGGCGGGGGGCGG + Intronic
998934086 5:147216033-147216055 TGGGAGCTGCAGGCCGGAGTTGG - Intergenic
1001035256 5:168292331-168292353 CTGGAGCCGCCGGCCGGGACTGG + Intronic
1001462048 5:171924694-171924716 CAGGAGCCGTGGGCCAGAGCAGG + Intronic
1002418728 5:179134735-179134757 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002418736 5:179134767-179134789 CGGGAGCTGGGGGATGGAGCCGG - Intronic
1002418744 5:179134787-179134809 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418752 5:179134807-179134829 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418760 5:179134827-179134849 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418768 5:179134847-179134869 CGGGAGCTGGGAGCTGGAGCCGG - Intronic
1002418779 5:179134880-179134902 CGGGAGCTGGGGTCTGGAGCCGG - Intronic
1002418786 5:179134900-179134922 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418794 5:179134920-179134942 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418803 5:179134946-179134968 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002418806 5:179134959-179134981 CCGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418822 5:179135000-179135022 CGGGAGCTGGGGACTGGAGCCGG - Intronic
1002418830 5:179135026-179135048 CGGGAGCTGGGGGCTGGAGCTGG - Intronic
1002418838 5:179135046-179135068 CGGGAGCTGGGAGCTGGAGCCGG - Intronic
1002418849 5:179135079-179135101 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418857 5:179135099-179135121 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418865 5:179135119-179135141 CGGGAGCTGGGAGCTGGAGCCGG - Intronic
1002418871 5:179135139-179135161 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418880 5:179135165-179135187 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002540103 5:179900973-179900995 CGGGTGCCACGGGCTGGAGCAGG - Intronic
1002638381 5:180619187-180619209 GGGGCGCCGCGGGCGGGAGGGGG - Intronic
1002896187 6:1381921-1381943 CGGGAGCCGCGAGCAGGTGACGG + Intergenic
1003482490 6:6546366-6546388 GGAGAGCCGCGCGCCTGAGCCGG + Intergenic
1003645415 6:7910249-7910271 CGGGCGCCGCGGCTCGGGGCCGG - Intronic
1003882564 6:10491641-10491663 GGAGAGCCGCGGGCGGGAGCCGG + Intergenic
1004561924 6:16760405-16760427 CGGCAGCCGCCGCCCGGAGCCGG - Intronic
1004606570 6:17200611-17200633 AGAGAGACGCGGGCTGGAGCTGG + Intergenic
1006121155 6:31806769-31806791 CGCGGGCAGCGGGCCGGACCGGG + Exonic
1006303886 6:33207834-33207856 CAGGAGCCGCGGCCCGGGGCGGG - Intergenic
1006334068 6:33411249-33411271 AGGGAGCCGGGGGTCGGCGCGGG + Intronic
1007589610 6:43013486-43013508 CAGGAGCCTCGGGGAGGAGCTGG - Intronic
1007701920 6:43770787-43770809 GGCGAGCCGCGGGCAGGGGCCGG + Exonic
1008673364 6:53795178-53795200 GCGGAGCCGCCGGCCAGAGCGGG + Exonic
1009645572 6:66396368-66396390 CAGGAGCCGTGGGCCTGAGGAGG + Intergenic
1010044179 6:71420870-71420892 CTGGAGCCAGGGGGCGGAGCGGG - Intergenic
1010489036 6:76452479-76452501 CTGGAGCCGCGGGCTGGAGTGGG - Intergenic
1011603594 6:89081389-89081411 CGGGAGCCGCGGGCCGCAGCGGG - Exonic
1012401411 6:98845241-98845263 CGGGGCCCGCGGGGCGGGGCGGG - Intergenic
1013207417 6:107957787-107957809 CGGACGCCGCGGGCTGGGGCCGG + Intronic
1013571348 6:111429723-111429745 GGCGAGCCGAGGGCGGGAGCGGG - Intronic
1015149232 6:130019869-130019891 CGCGGGCCGCGGGCCGGGCCGGG + Intronic
1015328504 6:131951068-131951090 TGGCAGCCGCCGGCCGCAGCGGG + Intronic
1016386728 6:143536982-143537004 CGGGAGCCGATGGCCGAGGCGGG + Intronic
1017396195 6:154002520-154002542 CAGGAGCCACGGGCTGGAGTCGG - Intergenic
1017738132 6:157381660-157381682 CGGGGGCTGCGGGGCCGAGCGGG + Exonic
1018109433 6:160520626-160520648 CGAGAGGCGCGGGCGGGAGCCGG - Intergenic
1018469132 6:164080802-164080824 CGGGACCCTCAGGCAGGAGCTGG - Intergenic
1019292915 7:259013-259035 CGGCAGCTGCGTGCGGGAGCAGG - Intronic
1019417943 7:935751-935773 CGGCACCCGCGGGGCAGAGCAGG - Intronic
1019521302 7:1461662-1461684 CGGGTGCTGGGGGCCGGTGCGGG - Intergenic
1019538625 7:1541478-1541500 CGGGAGCCGTGTGCGAGAGCAGG + Exonic
1019745988 7:2700652-2700674 CGGGAGCCTCGGGTCGGCTCAGG - Exonic
1020130499 7:5556335-5556357 CAGGGGCCGCGGGCCGGGGGCGG - Intronic
1020278205 7:6637239-6637261 CGGGGGCAGCGGCGCGGAGCGGG - Intergenic
1021450337 7:20778272-20778294 GGGGAGCGGCGGGCCCGGGCCGG + Intergenic
1021716984 7:23469743-23469765 GCAGAGCCGCGGGCCGGAGTGGG + Intronic
1022020939 7:26398807-26398829 CGGGACCAGCGGGCGGGAGCAGG - Intergenic
1022207605 7:28179779-28179801 CGGCGGCCGCGGGCGGGGGCCGG - Intronic
1023418111 7:39950670-39950692 GGGGAGGCGGGGGCCTGAGCTGG + Exonic
1023934539 7:44730099-44730121 CTGGAGCCACGGGCCAGAGTGGG + Intergenic
1024965870 7:55021253-55021275 CGGGAGACGCGGGCCTGCTCCGG + Intronic
1025032894 7:55572064-55572086 CGGAAGGCGCGGACCGGGGCGGG + Intronic
1025959061 7:66205003-66205025 GGGGAGCCGCGGGCAGGTGGCGG - Intergenic
1026806790 7:73433983-73434005 CGGGAGGCCCGGGCCGAAGGCGG - Exonic
1029392957 7:100287707-100287729 CAGGAGCCGGTGGCCAGAGCTGG - Intergenic
1029414760 7:100435937-100435959 CTGGAGCTGCGGGCCGCAGCCGG - Exonic
1029440499 7:100584422-100584444 AGGGGGCCGGGGGCGGGAGCTGG + Intronic
1029448276 7:100626911-100626933 GGGGAGGCGCGGGCTGGGGCTGG + Intronic
1029849367 7:103446209-103446231 CGGGAGTCGCGGGGCGCGGCCGG - Intergenic
1032117059 7:129126494-129126516 CGGGCTCCGCGGGCCGGTGGCGG - Intergenic
1033220392 7:139523632-139523654 CGGGAGCCGTGGACCCGGGCGGG - Intergenic
1033299820 7:140176344-140176366 CGGGCGCGGCGGGGCGGGGCGGG + Intronic
1033477031 7:141701747-141701769 CGGGAGCCCGGGGCCGGCCCTGG + Intronic
1034147063 7:148883593-148883615 GGGGAGGCGCGGGCCGCTGCCGG - Intronic
1034174620 7:149090811-149090833 CGGCAGCCGCGGCCGGGCGCCGG - Intergenic
1034198070 7:149262785-149262807 CGGGAGCCTCACGCCGGGGCAGG + Intronic
1034418770 7:150978340-150978362 CGGGAGGCGGGGGCCGGAGCCGG - Intergenic
1034622226 7:152464540-152464562 GGTGAGCCGCTGGGCGGAGCCGG + Intergenic
1034941992 7:155236668-155236690 CGTGAGCCCTGGGCTGGAGCAGG - Intergenic
1034951070 7:155297586-155297608 CGGGGCACGCGGGCCCGAGCGGG - Intergenic
1035167450 7:157000067-157000089 GGGGAGCCCGGGGGCGGAGCGGG + Intronic
1036708040 8:11059622-11059644 CGGGGGGCGCGGGGCGGGGCGGG + Intronic
1037811445 8:22089328-22089350 CGGGAGTCGCGGGCCTAGGCCGG + Intronic
1037820085 8:22131179-22131201 CGGGTGCCGCGGGGGGGAGGGGG - Exonic
1037901415 8:22691527-22691549 TGGGCGCCGCGGCCCGGAGCCGG - Intronic
1039554780 8:38468053-38468075 CGGGGGCGGCGGGCCGGAGCCGG - Intronic
1039911162 8:41828250-41828272 CGGGCGGAGCGGGGCGGAGCGGG - Intronic
1039921229 8:41895970-41895992 CGGGTGCGGCGCGCCCGAGCAGG + Intronic
1039996883 8:42541758-42541780 CGGGCGGCGCGGGGCGGGGCCGG - Intronic
1040423434 8:47261039-47261061 GGGAAGCGGCGGGCCGGCGCGGG + Intronic
1040981740 8:53251666-53251688 CGGGACCGGCGGGACGCAGCCGG + Exonic
1041151930 8:54944172-54944194 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
1042190060 8:66177381-66177403 CCTGAGCCGCGGGCCGGTCCCGG - Exonic
1042857898 8:73285897-73285919 CGGGAGACGCCGGCCGGGCCGGG - Intergenic
1043401895 8:79892042-79892064 CGGGAGCCGCGGGAGGGGACGGG - Intergenic
1044302916 8:90606456-90606478 CGGGAGGCGCGGGCGGGAGCCGG - Intergenic
1045111122 8:98940328-98940350 CGGCAGCCGAGGGCCTCAGCTGG + Intronic
1045277579 8:100721647-100721669 CCGGGGCTGGGGGCCGGAGCCGG + Exonic
1045678448 8:104633244-104633266 GGAGAGGCGCGGGCGGGAGCCGG - Intronic
1045797634 8:106064982-106065004 TGGGAGCTGCAGACCGGAGCTGG - Intergenic
1047454803 8:124998872-124998894 CGGGGGCTGCGGGCCGGCGCGGG - Exonic
1047526605 8:125639070-125639092 CGGGAAGAGCGGGCAGGAGCAGG + Intergenic
1047998478 8:130358259-130358281 CGGGAGCCGCGCGCCAGGCCGGG - Intronic
1048655448 8:136530769-136530791 GGAGAGGCGCGGGCCGGAACCGG - Intergenic
1049109607 8:140635143-140635165 CGGGGCCCGCGGGCTGGGGCCGG - Intronic
1049109890 8:140635872-140635894 TGGGAACCGCGGGCGGGAGCGGG + Intergenic
1049411452 8:142475643-142475665 CGGGCGGGGCGGGGCGGAGCCGG + Intronic
1049435596 8:142584771-142584793 TGGGAGCCGTGGGCTGCAGCAGG - Intergenic
1049529217 8:143146102-143146124 CGGGAGGGGCGGGCCAGATCAGG - Intergenic
1049532234 8:143160332-143160354 CGCGAGGGGCGGGGCGGAGCCGG + Intronic
1049649928 8:143761155-143761177 CCGGAGCCGCGCGCCCGAGAAGG + Intergenic
1049850335 8:144827217-144827239 CTGGGGACGCGGGCCGGGGCCGG - Intergenic
1053600130 9:39602136-39602158 AGGGAGCCTCCGGCAGGAGCAGG + Intergenic
1054175050 9:61869176-61869198 CCGGGGCCGGGGGCCGGGGCCGG + Intergenic
1054253395 9:62740248-62740270 AGGGAGCCTCCGGCAGGAGCAGG - Intergenic
1054567511 9:66774747-66774769 AGGGAGCCTCTGGCAGGAGCAGG - Intergenic
1054662487 9:67711617-67711639 CCGGGGCCGGGGGCCGGGGCCGG - Intergenic
1056992420 9:91423951-91423973 CGGCAGGGGCGGGCCGGGGCGGG + Intergenic
1057922043 9:99105333-99105355 CGGGGCGCGCGGGCCGGACCCGG + Intronic
1058904739 9:109473543-109473565 CGGGAGCCGCGGGCAGTTTCGGG + Intronic
1059769856 9:117414888-117414910 CCGGAGCCCCGAGCCGGGGCCGG + Exonic
1059769910 9:117415086-117415108 CGGGAGGCGGAGCCCGGAGCTGG - Intergenic
1060224062 9:121780759-121780781 AGGGAGCAGCAGGACGGAGCCGG + Intronic
1060530034 9:124342594-124342616 CAGGAGCCTCGTGCCGGAGGCGG - Intronic
1060825029 9:126683039-126683061 CGGGAGCCCCCAGCCGGGGCTGG - Intronic
1061044231 9:128155944-128155966 CTGGAGCCACAGGCCAGAGCAGG + Intergenic
1061666145 9:132161988-132162010 CCGGAGACGCGGGCCGGGGGAGG - Exonic
1061898090 9:133658841-133658863 CGGGAGCAGCGGGGCGGGGGCGG - Exonic
1062162398 9:135087624-135087646 CGGGGGCCGCGGCCGGGAGGCGG - Intronic
1062231444 9:135484219-135484241 CAGCAGCCCCGGGCTGGAGCAGG + Intronic
1062325118 9:136009232-136009254 AGGAAGCCGCGGGGTGGAGCAGG - Exonic
1062349878 9:136133395-136133417 CGGGAGCCGCGGGAAGGACAAGG - Intergenic
1062393723 9:136344168-136344190 GGGGAGGCGCGGACAGGAGCGGG + Intronic
1062393731 9:136344190-136344212 GGGGAGGCGCGGACAGGAGCGGG + Intronic
1062535957 9:137021198-137021220 CGGGAGCCCAGGACAGGAGCTGG + Intronic
1062544165 9:137054235-137054257 CGGGAGCCGGGGGGCGGTGCTGG - Intergenic
1062574550 9:137200189-137200211 TGGGGGCCGCGGGCGGGGGCCGG + Exonic
1062591940 9:137278259-137278281 TGGGAGCCGCGGGCGGGGGCAGG + Intronic
1062596423 9:137301941-137301963 CGCGGGCCGCGGGCCGGGCCGGG + Exonic
1062707449 9:137953338-137953360 TCGGAGCCGTGGGCCTGAGCAGG - Intronic
1185508228 X:644318-644340 CCGGGGGCGCGGGGCGGAGCAGG + Intronic
1188451199 X:30309356-30309378 CGGGCGCCGCGGGCCATGGCGGG - Exonic
1188483054 X:30653656-30653678 CGGGAGTCGGGGGACGGAGGGGG + Intronic
1190056866 X:47186199-47186221 CTGGAGCCCGGGGCCGGGGCCGG + Intronic
1190323425 X:49191667-49191689 CGGGAGGCGCGCGCAGGAACGGG + Exonic
1192624599 X:72714286-72714308 CGGGAGACGCGAGCGGGAGGCGG + Intronic
1195884561 X:109625238-109625260 AGGCGGCCGCGGGCCGGAGGGGG - Intronic
1198047017 X:132913310-132913332 CTGGGGCTGCGGGCTGGAGCAGG + Intronic
1198177615 X:134172176-134172198 TGCGAGGGGCGGGCCGGAGCTGG - Intergenic
1199600764 X:149540077-149540099 CGGGAGAAGCGGGGCGGGGCAGG - Intergenic
1199832903 X:151562742-151562764 CAGGAGCCGACGGCCGGGGCAGG + Intergenic
1200098142 X:153673711-153673733 CGGCGGCCGCGGGCCGGATCCGG + Intronic
1200128432 X:153829095-153829117 CGGGAGCCGAGGGGCAGGGCGGG - Intronic
1200138437 X:153885942-153885964 CGGTTACCGCGGGCCGGACCGGG + Intronic
1200235893 X:154467560-154467582 CGGGAGCTGCCGGCTGCAGCGGG - Exonic