ID: 963870400

View in Genome Browser
Species Human (GRCh38)
Location 3:150409098-150409120
Sequence AAGGAAGGAGGAGCCGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963870391_963870400 25 Left 963870391 3:150409050-150409072 CCGCCTCTGAGGGAATTGAATTG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 963870400 3:150409098-150409120 AAGGAAGGAGGAGCCGCCGCGGG 0: 1
1: 0
2: 1
3: 23
4: 213
963870392_963870400 22 Left 963870392 3:150409053-150409075 CCTCTGAGGGAATTGAATTGAGG 0: 1
1: 0
2: 0
3: 11
4: 115
Right 963870400 3:150409098-150409120 AAGGAAGGAGGAGCCGCCGCGGG 0: 1
1: 0
2: 1
3: 23
4: 213
963870395_963870400 -3 Left 963870395 3:150409078-150409100 CCGCGGCTGCGAGAGCTAAAAAG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 963870400 3:150409098-150409120 AAGGAAGGAGGAGCCGCCGCGGG 0: 1
1: 0
2: 1
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963870400 Original CRISPR AAGGAAGGAGGAGCCGCCGC GGG Exonic
900159596 1:1217267-1217289 CAGGGAGGAGGCGGCGCCGCGGG + Exonic
900380183 1:2380065-2380087 AAGGAAGGAGGAGCTGGCACAGG + Intronic
900797721 1:4719472-4719494 AAGGAAACAGGAGCCGTTGCAGG + Intronic
901059388 1:6465170-6465192 AAGGCAGGTGGAGTTGCCGCAGG + Exonic
901081126 1:6584831-6584853 AAGGTGGGAGGAGCTGTCGCAGG + Intronic
901425839 1:9182173-9182195 CAGGAAGGAGGACCCGGCGGCGG - Intergenic
901604719 1:10450171-10450193 CAGGAAGGAAGAGCAGCAGCAGG + Exonic
902117921 1:14137089-14137111 GAGGAAGGAAGGGCCGCTGCTGG + Intergenic
902768245 1:18630951-18630973 ACGGAAGAAGGAGCCTCCTCGGG - Intergenic
903224103 1:21885195-21885217 AAGGAAGGAGGAGCGGAAGGAGG + Intronic
903333431 1:22609222-22609244 AAGGAAGGAGAAGGCACCCCGGG + Intergenic
905462377 1:38130102-38130124 AAGGACAGAGGAGGGGCCGCTGG + Intergenic
905633319 1:39531129-39531151 GAGGAAGTAGGAGCCACCCCTGG + Intergenic
912804447 1:112744194-112744216 TGGGAAGGAGAAGCCTCCGCCGG - Intergenic
915016404 1:152737958-152737980 AAGGAGGGAAGAGCAGCAGCAGG - Intronic
915459299 1:156060312-156060334 AAGGAATGAGGAGCCCCAGGAGG - Intergenic
915459540 1:156061546-156061568 AAGGAATGAGGAGCCCCAGGAGG - Intronic
916481353 1:165217452-165217474 AAGGAAGGAGCAGCCACCTGTGG - Intronic
917817587 1:178725787-178725809 AAGGAAGACTGAGGCGCCGCTGG - Intronic
920013966 1:202890688-202890710 AAGGAAGGAGGAGCCACATGAGG - Intergenic
922244009 1:223777221-223777243 GAGGAAGGAGAGGCCGCAGCAGG - Intergenic
1069711635 10:70493110-70493132 AAGGAAGCAGCAGCGGCAGCTGG - Intronic
1069774022 10:70916483-70916505 AAAAAAGGAGGAGCCTCTGCAGG - Intergenic
1070637242 10:78139407-78139429 AGGGAGGGAGGAAGCGCCGCAGG - Intergenic
1070664822 10:78335688-78335710 AAGGAAGATGAAGCCGCCCCTGG + Intergenic
1072891501 10:99329313-99329335 GAGGGAGGAGGAGCCGGAGCTGG - Exonic
1074913650 10:117935614-117935636 GAGGAAGGAGGAGATCCCGCTGG - Intergenic
1075729808 10:124629373-124629395 AGGGAAGGAGGAAACGCAGCTGG - Intronic
1076727696 10:132421202-132421224 ACTGAGGGAGGAGCCGCGGCAGG + Intergenic
1076739746 10:132477395-132477417 CAGGAAGGAGGAGCAGCCTCTGG - Intergenic
1076830829 10:132993336-132993358 AACGTAGCAGGAGCTGCCGCAGG - Intergenic
1077026438 11:441979-442001 CAGGTAGGAGCACCCGCCGCTGG - Exonic
1077318869 11:1931996-1932018 AAGGAAGGAGGAGAGGGGGCTGG - Intronic
1077386816 11:2273152-2273174 AATGAAGGAGGGGCCGAGGCAGG - Intergenic
1077499950 11:2904809-2904831 AAGGAAGCAGGAGAGGCCCCGGG + Intronic
1077536981 11:3129178-3129200 AAGGAAGGAGGGGCAGCAGGAGG + Intronic
1078475053 11:11622490-11622512 AAGGAAGGAGTGGATGCCGCTGG - Intergenic
1080586806 11:33689938-33689960 AAGGAATGAGGTGCTGCCACTGG - Intergenic
1082786983 11:57322692-57322714 GAGGAAGGAGGAGCCGGCCCAGG + Intronic
1083622591 11:64056446-64056468 GAGGAAGGGGGAGCAGCTGCGGG + Intronic
1084753781 11:71221984-71222006 GAGGAAGCAGGAGAAGCCGCTGG + Intronic
1085321583 11:75577409-75577431 AAGGCAGCAGGAGCCTCCGCAGG - Intergenic
1085344596 11:75760049-75760071 TAGGGAGGAGGAGCTGCCTCAGG - Intronic
1088799869 11:113295879-113295901 AAGGAAGGACGAGCTGGCGGTGG - Intergenic
1089499837 11:118925564-118925586 AGGGAAGGAGGAGCAGGAGCAGG - Intronic
1089655078 11:119941279-119941301 AAGAAAGGAGGATCCACAGCAGG - Intergenic
1089674099 11:120078271-120078293 AAGGAAGCAGGAACCCACGCTGG - Intergenic
1091474077 12:754084-754106 GAGCAAAGAGGAGCCGCCGCCGG + Exonic
1091620266 12:2082409-2082431 AAGGATGCAGGAGACGCTGCCGG - Intronic
1092695931 12:11171363-11171385 AAGGAGGACGGAGCCGCCGCGGG - Intronic
1095672422 12:44876392-44876414 GAGGAGGGAGGGGCCGCCGAGGG + Intronic
1096741587 12:53697477-53697499 AGGGCAGGAGGAGCCGCAGAAGG - Intergenic
1099908362 12:88799178-88799200 AGGGAAGGAGGAGCAGCAGGAGG + Intergenic
1100936955 12:99680443-99680465 AAGGAAGAAGAAGCAGCAGCAGG + Intronic
1102721624 12:115021531-115021553 AGGGAAGGAGGAGTCTCAGCTGG - Intergenic
1104600938 12:130152851-130152873 AAGGCAGAAGGAGCCTCCTCTGG - Intergenic
1104730646 12:131103606-131103628 AATGAGGGAGGAGATGCCGCAGG - Intronic
1104769600 12:131352834-131352856 AAGGAAGGAGGAGCAGCAACTGG - Intergenic
1104850730 12:131872288-131872310 AAGGCAGGCAGAGCCGCCACAGG - Intergenic
1106694894 13:32162773-32162795 AAGGAAGAAGGATCCACGGCTGG - Intronic
1108313602 13:49218364-49218386 AAGGAAGGAGGAGCCAGCGATGG + Intergenic
1111032040 13:82613568-82613590 AAAGAAGGAGAAGCAGCAGCAGG - Intergenic
1112191849 13:97185896-97185918 AAGGAAGGAGGAGCCACCAGAGG - Intergenic
1113906081 13:113819812-113819834 AAGGATGTCGGAGCCGCAGCTGG - Intergenic
1116928610 14:50668052-50668074 AGGGAAGGAGGCGGCGGCGCCGG - Exonic
1119134587 14:72205137-72205159 AAGGAAGGAGAAGCCTCCCCTGG + Intronic
1119982318 14:79096050-79096072 AGGGAAGGAGGAGGGGCCTCAGG - Intronic
1121751661 14:96363073-96363095 AGGGATGGAGGGGCCGCCCCAGG - Exonic
1123981909 15:25612491-25612513 CAGGAAGGAGGAGAAGCCTCAGG - Intergenic
1124475166 15:30026828-30026850 GAGGCAGGAAGAGCCCCCGCAGG + Intergenic
1128061818 15:64740297-64740319 AAAGAATGAGGAGCAGCGGCGGG + Exonic
1128742787 15:70095647-70095669 AGGGCAGGAGGAGCCGGCTCAGG + Intronic
1129723275 15:77889291-77889313 AAGGAGGGAGGGGCTGCCTCTGG - Intergenic
1132041550 15:98528834-98528856 AGGGAAGGAGGAGGCGCTGCTGG + Intergenic
1132354224 15:101159365-101159387 CAGGAAGGGGAAGCCGCCTCCGG - Intergenic
1132670630 16:1100891-1100913 AAGGACGGAGGAGCCAGCACTGG + Intergenic
1132793250 16:1705707-1705729 AAGGAAGGAGGCCACGCTGCTGG + Intergenic
1133002402 16:2857994-2858016 GAGGAGGGAGGAGCAGCCTCCGG + Intronic
1133229203 16:4358494-4358516 AAGGGAGTCGGAGCTGCCGCTGG + Intronic
1133528639 16:6631759-6631781 TAGGGAGGAGGAGCAGCCACCGG + Intronic
1135158608 16:20074168-20074190 GAGGAGTGAGGAGCCGCTGCGGG - Intergenic
1137665301 16:50246103-50246125 GGGGAAGGAGGAGCGGCCGCAGG - Intergenic
1137830015 16:51535696-51535718 AAGCAAGGAGGAGGCGGCGAGGG + Intergenic
1138590944 16:57999627-57999649 AAGGAAGGAGAAGCCTTCACAGG + Exonic
1142170459 16:88619408-88619430 AAGGAAGGTGGTGCGGCCGGCGG + Intronic
1143740445 17:8949007-8949029 CAGGAAGGAGGAGCTGCCCTGGG + Intronic
1144548027 17:16215582-16215604 GAAGGAGGAGGAGCCGGCGCTGG - Intronic
1144658468 17:17052969-17052991 AGGGAAGGGGGAGCAGCTGCAGG + Intronic
1147673283 17:42189152-42189174 AGGGAAGGGAGAGCCCCCGCAGG + Exonic
1148059984 17:44829896-44829918 AAGGAGGGGGGCGCCGCCGAGGG - Intronic
1150320710 17:64212124-64212146 AAGGAAAGAGGAGCACCAGCAGG + Intronic
1150484902 17:65536971-65536993 AGGGAAGGAGGGGCCCCCGGCGG - Exonic
1151358067 17:73571933-73571955 GGGGAAGGAGGAGCGCCCGCGGG + Intronic
1151802334 17:76385567-76385589 AAGGCAGGAGCCGCCGCCACGGG + Exonic
1152863834 17:82710649-82710671 TAGGATGGAGGTGACGCCGCAGG + Intergenic
1152898024 17:82924820-82924842 AACAAAGGAGGAGCCGCCTGAGG - Intronic
1153098475 18:1436770-1436792 AAGGAAGGAAGAGCCAGCCCTGG + Intergenic
1153303444 18:3611604-3611626 AAGGAAGCAGGGGCTGCAGCGGG - Intronic
1153791672 18:8584747-8584769 ACAGAAGGAGGAGCAGCAGCAGG + Intergenic
1153875086 18:9363024-9363046 TAGGAAGGAGGAGCAGCGGCAGG - Intronic
1157815582 18:50727558-50727580 GAGGAAGGGGAAGCTGCCGCAGG - Intronic
1158521779 18:58177123-58177145 AAGGAATGAGGAGGGGCCGGCGG - Intronic
1161249123 19:3270969-3270991 AGGGAGGGAGGGGCGGCCGCGGG - Intronic
1162029322 19:7910591-7910613 GAGGGAGGAGGAGACGCTGCAGG - Intronic
1162733747 19:12734399-12734421 GCGGCAGGAGGAGCCGCCCCCGG - Exonic
1163329635 19:16628137-16628159 AAAGGAGGAGGAGGAGCCGCCGG + Exonic
1165448223 19:35868479-35868501 CAGGAAGGCGGGGCCGGCGCGGG + Exonic
1166840259 19:45692874-45692896 CAGGACTGAGGAGCTGCCGCTGG + Exonic
1167245981 19:48373455-48373477 GAGGAAGGAGGAGCAGCTTCAGG + Intronic
1167473032 19:49685941-49685963 AGTGAAGGAGGAGCCGAGGCTGG + Intronic
925078307 2:1038456-1038478 AAGGAAGGCGGAGCTTCCTCGGG - Intronic
925352113 2:3208757-3208779 AAGGAAGAAGGACTCGCCACGGG - Intronic
926113153 2:10195351-10195373 AAGGAAGGAAGAGCGGACACAGG + Intronic
928450683 2:31375529-31375551 CTGGAAGGAGGAGCTGCTGCAGG - Exonic
932688991 2:73896572-73896594 AAGGAAGGAGGAGCAGTGGGAGG + Intronic
933654916 2:84879743-84879765 AAGGCAGGAGGCGCGGCAGCTGG - Intronic
933713689 2:85345210-85345232 AAGGAAGGAGAGGCTGGCGCTGG + Intronic
934526361 2:95054244-95054266 TAGGAAGGAGAAGCTGCCCCTGG - Intergenic
935172252 2:100619582-100619604 AAAGAAGGAAGAGCCGATGCTGG + Intergenic
935574853 2:104698714-104698736 AAGAAAGGGGGAGCCTCAGCTGG + Intergenic
935749552 2:106219321-106219343 CAGGCAGAAGGAGACGCCGCAGG + Intergenic
936121746 2:109751996-109752018 CAGGCAGAAGGAGACGCCGCAGG - Intergenic
936222949 2:110619476-110619498 CAGGCAGAAGGAGACGCCGCAGG + Intergenic
936861552 2:117026359-117026381 AAGGCAGGAGAAGCCCCGGCAGG + Intergenic
936964871 2:118117758-118117780 AAGGAAGGAGCAGACCCAGCTGG + Intergenic
937814938 2:126240908-126240930 AAGGAAGGAGGGGGCGCGGCTGG - Intergenic
938101618 2:128501445-128501467 AAGGAAGGAGAGGCTGCCGAGGG - Intergenic
938168579 2:129055421-129055443 GAGGAAGGAGGTGCCGCTGTGGG - Intergenic
938383035 2:130847273-130847295 GAGGAAGCAGGAGACGCCCCTGG - Intronic
939758178 2:146138914-146138936 AAGGAAGAAGAAGCCTCTGCTGG + Intergenic
940558529 2:155263895-155263917 AAGGTGGGAGAAGCCCCCGCAGG - Intergenic
944415054 2:199471616-199471638 CCGGTAGGGGGAGCCGCCGCGGG + Intergenic
945183247 2:207113390-207113412 AAGGCAGGATGAGGGGCCGCAGG + Intronic
945594806 2:211778103-211778125 AAGGCAGGAGAAGCCACGGCAGG + Intronic
946191637 2:218010662-218010684 GAGGAAGGAGCAGCAGCCGCGGG + Intergenic
947635131 2:231676578-231676600 AAGAAAGGAGGAGCTGGCTCAGG + Intergenic
947682176 2:232044802-232044824 AAGGAAGGAGGAACAGCAGCAGG + Intronic
948398852 2:237668073-237668095 AATGCAGGAGGAGCAGCTGCTGG - Intronic
1169208382 20:3752528-3752550 ATGGCAGGAGGAGCCGCAGGAGG + Exonic
1170756776 20:19212409-19212431 ACGGTAGGAGGGCCCGCCGCTGG - Intergenic
1172102660 20:32494833-32494855 AAGAATGGAGGAGCCGCCGCTGG - Intronic
1172961879 20:38805802-38805824 AAGGAGGGTGGTGGCGCCGCCGG - Intronic
1172973467 20:38889774-38889796 GAGGGAGGAGGAGCTGCAGCTGG + Intronic
1174534356 20:51239202-51239224 CAGGAAGCAGCAGCCGCAGCAGG + Intergenic
1175891432 20:62317754-62317776 AAGGAAGCAGGAGCTGTCCCGGG - Exonic
1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG + Intronic
1176668128 21:9706060-9706082 AAGGAAGGCGGGAGCGCCGCGGG - Intergenic
1182071190 22:27464913-27464935 CAGTAAGGAGGAGCCACCACAGG + Intergenic
1182124301 22:27805062-27805084 AGGGAAGGAGGAGACACAGCTGG + Intergenic
1182765814 22:32757591-32757613 AAGGTAGGAGGAGCCCAGGCCGG - Intronic
1182835510 22:33338291-33338313 AAGGAAGGAGGTGCCACTGCTGG - Intronic
1182865763 22:33602927-33602949 ATGGGAGGAGGAGCAGCAGCTGG - Intronic
1184250410 22:43257076-43257098 GAGGAAGGGAGAGCCACCGCAGG + Intronic
950331232 3:12157801-12157823 AAGGGAGGAGGAGCCCCTTCAGG + Intronic
950683659 3:14602207-14602229 GAGGAAGGAGGACCCGCGCCTGG - Intergenic
951962884 3:28348819-28348841 AAGGAGGGACGAGCCGAGGCAGG + Exonic
953416665 3:42724432-42724454 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
953782884 3:45886921-45886943 AAGGAAGGAGAAGCAGGTGCTGG + Intronic
954264231 3:49460631-49460653 AAGGTAGGAGGAGCAGCTGCTGG + Intergenic
954368277 3:50157285-50157307 AAGAAACGAGGAGCCGGGGCTGG - Intronic
955937011 3:64111757-64111779 GAGGAAGGAAGAGCAGCGGCTGG + Intronic
956750301 3:72339790-72339812 AGGGAAGCAGGAGCCGCTGGAGG + Intergenic
959390749 3:105770411-105770433 AAAAAAGTAGGAGCCGCAGCAGG + Intronic
960803630 3:121562394-121562416 AAGAAAGGAGGAGCTGCCTGAGG + Intergenic
961346036 3:126263955-126263977 AAGGGAGGAGGAGAGGCAGCTGG + Intergenic
963870400 3:150409098-150409120 AAGGAAGGAGGAGCCGCCGCGGG + Exonic
964720792 3:159765348-159765370 GAGGAAGGAGGAGCAGCCAGAGG + Intronic
967904083 3:194486733-194486755 AGGGAAGGAGGCGCCGCGGCGGG + Intronic
968285373 3:197505527-197505549 AAGGGCGGAGGAGCTGCCGATGG - Intergenic
968293248 3:197555125-197555147 GGGGAAGGAGGAGGAGCCGCGGG - Intronic
968618199 4:1591822-1591844 AAGGAAGGAGGAGCCCTGGAGGG - Intergenic
968921660 4:3525294-3525316 CAGGAATGAGCAGCCGCTGCTGG - Intronic
969697235 4:8741695-8741717 CATAAAGGAGGAGCCCCCGCTGG + Intergenic
973867030 4:55124882-55124904 CAGGCAGGAGGTGCCTCCGCAGG - Intronic
975701786 4:77074868-77074890 GAGGACAGAGGAGCCTCCGCTGG - Intronic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
981366668 4:143912150-143912172 AGGGAAGGAGGCGGCGGCGCCGG - Intergenic
982254372 4:153437791-153437813 AAGGAAAGAGGATCTGCGGCCGG + Intergenic
983920119 4:173335179-173335201 AAGGAAGGAGGAGCCTTCTGAGG - Intergenic
984639341 4:182144770-182144792 AAGGAAGGAGGGCGCGCCGGCGG - Intronic
985631335 5:1015632-1015654 GAGGAAGCAGGAGCCACTGCTGG + Intronic
987050763 5:14144775-14144797 GCGGGAGGAGGCGCCGCCGCTGG - Intronic
991965671 5:72087970-72087992 AAGGAAAGAGGAGCTACCACGGG - Intergenic
995048080 5:107671990-107672012 AGGGAAAGAGGAGCAGCTGCGGG - Intergenic
997229954 5:132235043-132235065 AAGGAAGGACGAGTGGCTGCTGG - Intronic
997354402 5:133253192-133253214 AAGGAAGGAGGACCCGCCAGGGG - Intronic
997470921 5:134116203-134116225 AAGGAAGGAGGGGCCGCCCTGGG + Intronic
998269043 5:140690611-140690633 AACGAAGGAGTAGCAGCAGCAGG + Intronic
1002586723 5:180253257-180253279 AAGGAAGGGGGAGCAGCCAGAGG - Intronic
1003523024 6:6874729-6874751 AAGAACTGAGGAGCCCCCGCTGG + Intergenic
1004516530 6:16326602-16326624 AGCGTAGGGGGAGCCGCCGCCGG + Exonic
1005859033 6:29887593-29887615 AAGGAAGAAGGACCCGTCGCAGG - Intergenic
1005875253 6:30006440-30006462 CAGGAAGAAGGACCCGTCGCAGG - Intergenic
1006043351 6:31272206-31272228 CAGGAAGAAGGACCCGACGCAGG + Intronic
1006152970 6:31999107-31999129 AGGGTCGGAGGAACCGCCGCAGG + Exonic
1006159278 6:32031844-32031866 AGGGTCGGAGGAACCGCCGCAGG + Exonic
1006375173 6:33667988-33668010 GAGGAGGGAGGAGCAGGCGCCGG - Intronic
1006634476 6:35452319-35452341 AAGGAGGGAGGCGCGGCCGGGGG - Intergenic
1010187032 6:73156788-73156810 AAAGAATGAGGAGCAGCGGCAGG + Intronic
1012508694 6:99978083-99978105 AAGGAAGGAAGTGCAGCCGATGG + Intronic
1014975686 6:127879751-127879773 AAGGATGGAGAAGCTGCCTCTGG + Intronic
1015189336 6:130456272-130456294 AAGAAAGGAGAAGCAGCCACAGG + Intergenic
1017446344 6:154510322-154510344 GGGGAAGGAGGAGCTGCAGCTGG - Exonic
1017983520 6:159422815-159422837 AAGGAGGGAGGAGCAGTCACTGG - Intergenic
1018702954 6:166441849-166441871 AAGGAAGCTGGAGCAGCTGCCGG + Intronic
1019595974 7:1858591-1858613 CAGGTAGGAGGAGGCACCGCGGG - Intronic
1020262287 7:6537042-6537064 AGGGATGGAGGAGCAGTCGCAGG + Intronic
1021927502 7:25547495-25547517 GAGGAGAGAGGAGCCGCCCCTGG - Intergenic
1022536525 7:31101994-31102016 AAGGAAGGAGGAGACACAGGGGG - Intronic
1022615384 7:31924610-31924632 AAGGAAGGAGCAGCTGCTGGAGG - Intronic
1023579252 7:41663830-41663852 AAAGAAGGAGGAGTTGCCACAGG - Intergenic
1025950497 7:66141686-66141708 TAGGACCGAGGAGCAGCCGCTGG + Intronic
1031984247 7:128152790-128152812 AAGGAAGCAGGAGCTGCAGCTGG - Intergenic
1032416331 7:131738168-131738190 ACGGAAGGAGGAGCACCTGCGGG + Intergenic
1034782303 7:153891770-153891792 AAGGAAGGGGGAGACGCCAAGGG - Intronic
1035114704 7:156514941-156514963 AAGGAAGGAGGTAACGCAGCTGG - Intergenic
1035389863 7:158497022-158497044 AAGGAAGGGGGAGAGGGCGCAGG - Intronic
1035977646 8:4330755-4330777 AAGTAGGGAGGAGATGCCGCAGG - Intronic
1036749647 8:11435657-11435679 AAGGACAGAGGAGCAGCCCCTGG + Intronic
1038624289 8:29175736-29175758 CATGGAGGAGGAGCCTCCGCTGG - Intronic
1040487636 8:47888923-47888945 GAGGAAGCAGGAGCAGCTGCAGG + Intronic
1040815043 8:51498706-51498728 ATGGCAGGAGGAGCCTCCGTAGG - Intronic
1042580894 8:70278489-70278511 AGGGAAGGAGGAGTCACCCCAGG - Intronic
1042689465 8:71481823-71481845 AAGGAAGGAGGAGCAGGAGGAGG + Intronic
1043146469 8:76661676-76661698 AAGGAAGAAGGAGCCTGAGCTGG + Intergenic
1048572114 8:135664950-135664972 CAGGCATGAGGAGCGGCCGCTGG - Intergenic
1049299741 8:141863173-141863195 AAGGAGAGAGCAGCCGCCGGGGG + Intergenic
1049343825 8:142128035-142128057 CAGGAAGGAGGAGCAGCCTGGGG - Intergenic
1057668581 9:97067582-97067604 TGGGAAGGAAGAGCCGCGGCGGG + Intergenic
1058770175 9:108223401-108223423 AAAGAAGGAGGAGAAGCTGCAGG + Intergenic
1061542181 9:131283287-131283309 GAGGAGGGAGGGTCCGCCGCGGG - Intergenic
1062294401 9:135816402-135816424 AGGGAAGGAGGGGCCACAGCAGG + Intronic
1062399442 9:136366010-136366032 GGGGAAGGAGGAGCCGCAGACGG - Intronic
1062550391 9:137083406-137083428 AAGGCAGGAGTACCGGCCGCAGG - Exonic
1062569613 9:137179103-137179125 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
1196695471 X:118606962-118606984 AAGGAAGGGAGAGCCGGGGCAGG - Intronic
1199635559 X:149808721-149808743 AAGGACGTAGGAGTGGCCGCGGG - Intergenic
1199855528 X:151756143-151756165 AAGGAAGGAGGAGGGGCAGGAGG - Intergenic