ID: 963871728

View in Genome Browser
Species Human (GRCh38)
Location 3:150423025-150423047
Sequence TGTGAGATCCGAGAATCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963871728_963871732 28 Left 963871728 3:150423025-150423047 CCATTTGATTCTCGGATCTCACA 0: 1
1: 0
2: 0
3: 8
4: 131
Right 963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG 0: 1
1: 1
2: 0
3: 11
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963871728 Original CRISPR TGTGAGATCCGAGAATCAAA TGG (reversed) Intronic
903392099 1:22971773-22971795 TGAGAAATCTGAGACTCAAAAGG - Intergenic
903936467 1:26898568-26898590 GGTGACAGCCGAGAATCAAAAGG - Intronic
904928679 1:34068813-34068835 TGTGAGATCTGATAGTTAAAAGG + Intronic
906935519 1:50211043-50211065 TGTGGGACCCGGGATTCAAATGG - Intergenic
907569708 1:55471829-55471851 TGTGAGAACCAAGAAGCAAAAGG - Intergenic
908652435 1:66350377-66350399 TGTAAGAACAGAGAATAAAAAGG - Intronic
909331505 1:74417547-74417569 TGTGAGCTGTGAGAAACAAATGG - Intronic
909508318 1:76420514-76420536 TGCTAGATCTGAGAATAAAATGG - Intronic
912557700 1:110528252-110528274 TGTGAGCTCAGATAATCACAGGG - Intergenic
913373142 1:118122866-118122888 TGTGAGAGCAGAGAATGGAATGG + Intronic
917566966 1:176222749-176222771 TGTGAGCTCCAAGATTCAAATGG - Intergenic
920882871 1:209896660-209896682 TCTGAGATCCCTGATTCAAAAGG - Intergenic
922142402 1:222901897-222901919 TGTGAGATATAAGAATCAAAAGG + Intronic
1063138347 10:3236229-3236251 TGAGTGATCGGAGAATGAAAAGG + Intergenic
1064641686 10:17421516-17421538 AGTGAGATCTTAGAATTAAAAGG + Intronic
1070013384 10:72498717-72498739 TGTGGTATCTGAGGATCAAATGG - Intronic
1070694248 10:78550255-78550277 TGTTAGATCCCAGAAACAGAAGG - Intergenic
1071517102 10:86305471-86305493 AGTGAGGTCTGAGAATCACATGG - Intronic
1082224910 11:49693661-49693683 TGAGAGTTTAGAGAATCAAATGG + Intergenic
1085778169 11:79384566-79384588 TGGGAAATCCGAGAGTCAGAAGG - Intronic
1086364680 11:86096772-86096794 TCTGAGATCCCAGAATACAATGG + Intergenic
1087628889 11:100627594-100627616 TCTGAGATCAGAGAACCTAAAGG - Intergenic
1091153295 11:133349543-133349565 AGTGGGATCCGAGAAACAATAGG + Intronic
1095849048 12:46780401-46780423 TGAGAGATGGCAGAATCAAAGGG + Intronic
1097179861 12:57165560-57165582 AGTGTGACCTGAGAATCAAATGG - Intronic
1097200710 12:57276246-57276268 TGTGGGATTCCTGAATCAAATGG - Intronic
1098906793 12:76170725-76170747 AGTGAGATCAGAGAATCTGAGGG + Intergenic
1099496886 12:83359285-83359307 TGTGAGGTCAGAGAAACAACGGG + Intergenic
1101321675 12:103678380-103678402 TGAGAGGTCTGAGAACCAAAAGG - Intronic
1103584060 12:121937828-121937850 TGTGAGATCAGAGAAGCCACAGG - Intronic
1105043202 12:132978073-132978095 TGTGACATCAGCAAATCAAAGGG + Intergenic
1108716608 13:53085217-53085239 AGTGAGATGCAAGAAGCAAAGGG + Intergenic
1109041427 13:57343010-57343032 TGTGAGATTCAAGAATTCAATGG - Intergenic
1111910806 13:94310070-94310092 TTTAAGATCTGAGCATCAAAAGG + Intronic
1113159841 13:107367485-107367507 TGGGAGAGACGGGAATCAAATGG - Intronic
1122452758 14:101824086-101824108 TGCGAGCTCCGAAAATCAAGTGG - Intronic
1126190085 15:45870069-45870091 TGTGAAATCCCAGAATTAGATGG + Intergenic
1126957805 15:53953718-53953740 TGTGAGGTCATAGAATCAGAAGG + Intergenic
1127986177 15:64072443-64072465 TCAGAGATCTGAGAACCAAAAGG - Intergenic
1129099081 15:73241655-73241677 TGTGAAAGCTAAGAATCAAAAGG - Intronic
1129206497 15:74040306-74040328 TGTGAGGACCGGGAATCAAGGGG - Intronic
1131998099 15:98152323-98152345 TGGGAGATCAGTGAATCACAGGG + Intergenic
1132974321 16:2703853-2703875 TCCTAGATCCGAGACTCAAATGG - Intronic
1133131350 16:3677879-3677901 TGTGAGCTTTGGGAATCAAATGG - Intronic
1135649977 16:24197510-24197532 TGTGAGATCAGAGAGGCCAAAGG + Intronic
1135719154 16:24800239-24800261 TGTAAGTTGTGAGAATCAAAAGG - Intronic
1136173226 16:28500652-28500674 GGTGACATCAGAGAATCAGAGGG + Intronic
1141301788 16:82822839-82822861 TGTGAGAGACGATAATAAAATGG - Intronic
1144112834 17:12053805-12053827 TGTGAGATCTGAAAATCTGACGG - Intronic
1144165781 17:12609035-12609057 TTTGAGTTCGAAGAATCAAAAGG + Intergenic
1144229713 17:13189395-13189417 TGTGAGATACGAGACTGAAGTGG - Intergenic
1144340716 17:14308930-14308952 TGTGAGGTTTGAGAAGCAAATGG + Intronic
1146267772 17:31464357-31464379 TCTGGGAGCCCAGAATCAAAGGG + Intronic
1149026468 17:52032865-52032887 TGTGACATTTGAGAATGAAAGGG + Intronic
1156673007 18:39493200-39493222 TGTGAGATTGCAGAATCATATGG - Intergenic
1168384823 19:55954471-55954493 TGTGAGATGGGAGAAATAAAGGG - Intronic
1168459411 19:56540846-56540868 TGTGAGATCCCAGTAGCCAAGGG - Intronic
926242858 2:11101492-11101514 TGTTTGAGCCAAGAATCAAATGG + Intergenic
929248526 2:39728381-39728403 TCTGAGAACAGTGAATCAAAGGG - Intergenic
931936285 2:67200440-67200462 TGTGATATCAGGGAATCAAGGGG + Intergenic
932862982 2:75313659-75313681 TGTGAGATCCTGGAGCCAAAAGG + Intergenic
933331238 2:80895588-80895610 TGTGAGATAAGTGAATCTAAAGG + Intergenic
938989060 2:136609470-136609492 TGTGAGATCTTAGATGCAAATGG - Intergenic
939917767 2:148068427-148068449 AGTAAGATCCAAGAAACAAAAGG - Intronic
940672271 2:156685447-156685469 TGAGAGACCTGAGAATCAACTGG + Intergenic
940859401 2:158756783-158756805 TGGGAGATGCTAGACTCAAAAGG + Intergenic
944115350 2:196179887-196179909 TGTAAGATCCTATAATAAAAAGG + Intergenic
947410157 2:229829225-229829247 TGTGACATCCGAGGACCAAGAGG + Exonic
947756268 2:232567716-232567738 TGTGAGAGAGCAGAATCAAAGGG + Intronic
947861180 2:233359115-233359137 TTTGAAATCCGACAATAAAATGG - Intronic
948820289 2:240539728-240539750 TGTCAGATGCCAGACTCAAAAGG + Intronic
1169362793 20:4965338-4965360 GTTGAGATCCAAGAATAAAAAGG - Intronic
1171303561 20:24085245-24085267 TGTGAGATTCTAGAATCTCAGGG - Intergenic
1173187435 20:40851229-40851251 TGTGAAAGCCGAGAAAGAAAGGG - Intergenic
1177049670 21:16217247-16217269 TGTGAAATATGAGAATAAAAGGG - Intergenic
1178296451 21:31414367-31414389 TGTTAGATTCGAGAAGAAAAAGG - Intronic
1178341388 21:31788279-31788301 TGTGGGATCCAAGAAACCAATGG + Intergenic
1182773547 22:32813626-32813648 TCAGAGATCCGAGAATTGAAAGG - Intronic
949548512 3:5092929-5092951 TGTGATATCAGAGAACAAAACGG - Intergenic
951889802 3:27557796-27557818 TGGGAGCTCAGAGAAGCAAAAGG - Intergenic
955849796 3:63207686-63207708 TCTGAGATACTAGAATGAAAAGG + Intergenic
963165973 3:142203876-142203898 TGTGAGATTCCCGAGTCAAAGGG - Intronic
963871728 3:150423025-150423047 TGTGAGATCCGAGAATCAAATGG - Intronic
967660405 3:192101550-192101572 TGAGAGAAACCAGAATCAAAGGG + Intergenic
968264973 3:197355808-197355830 TGTGAGGTCCCAGGGTCAAAAGG - Intergenic
971498245 4:27290531-27290553 TGTAAGATCCCAAAAGCAAAAGG - Intergenic
974307999 4:60166280-60166302 AGAGAGATGCAAGAATCAAAAGG + Intergenic
979888381 4:126060736-126060758 TCACAGATCCGGGAATCAAAAGG - Intergenic
980565800 4:134538823-134538845 TATGAGATCCTAATATCAAATGG + Intergenic
983178593 4:164621261-164621283 TGATAGATCTGAGATTCAAAGGG + Intergenic
984186528 4:176550458-176550480 TGTAAGATCAGAGATTTAAATGG - Intergenic
984551669 4:181167531-181167553 TATGAGATCAGAGAAACTAAAGG + Intergenic
986239705 5:5949799-5949821 TGTGTGATAGGAGAATCAAAAGG - Intergenic
986596053 5:9423442-9423464 TGTGAGCTCCTAGAATCCATAGG - Intronic
988095696 5:26606488-26606510 TGTGAGACCAGAGAATGGAAAGG + Intergenic
989873878 5:46650648-46650670 TGTGAGGTCTGAGAAGGAAAAGG + Intergenic
992128124 5:73663975-73663997 TGTGAGAACTGAAGATCAAATGG - Intronic
995201935 5:109434906-109434928 TGAGAGATGCAAGAATTAAAAGG + Intergenic
996460421 5:123734292-123734314 TGTAAAATCCAAGAATCCAAAGG - Intergenic
996929544 5:128869559-128869581 AATGAGATCCGAGAAGTAAAGGG - Intronic
998790121 5:145757444-145757466 TGTGAAGTCTGAGAATCACAGGG + Intronic
1010293293 6:74165423-74165445 TGTGAGATGGTAGAATAAAAGGG - Intergenic
1010706320 6:79115740-79115762 TGTAAGATGAGACAATCAAAAGG - Intergenic
1013077403 6:106783491-106783513 TGTGAGCTCTGATAATCCAAGGG - Intergenic
1016882496 6:148924453-148924475 TGTGAGTTCAGGGAATGAAAGGG + Intronic
1020555349 7:9663760-9663782 TGTGGAATCTGAGATTCAAATGG - Intergenic
1021691670 7:23236161-23236183 TGTGAGCCGGGAGAATCAAACGG - Intronic
1024557787 7:50618272-50618294 TGTGTGATAGGAGAATAAAAAGG - Intronic
1031878065 7:127164105-127164127 TGTGAGATCCGATCATTTAAAGG + Intronic
1034950808 7:155296250-155296272 TGTGAGACCCGATAAGCAGAAGG - Intergenic
1035284276 7:157796309-157796331 TGTGAGATTCGGGAATGAATAGG - Intronic
1038734203 8:30154800-30154822 TGTGACATCCGAGACATAAAGGG + Intronic
1040776958 8:51056885-51056907 TGAGAGATCTGAGTATAAAAGGG - Intergenic
1043268381 8:78296754-78296776 TGTGAGATGATAGAAGCAAAGGG - Intergenic
1043483720 8:80678365-80678387 TGTGAGATGAGATATTCAAAAGG - Intronic
1044189145 8:89294016-89294038 TGTAAGGTCTGAGAAGCAAAGGG - Intergenic
1044377003 8:91486831-91486853 AGTGAGATTGCAGAATCAAATGG + Intergenic
1045578020 8:103447117-103447139 TGCAATATCCCAGAATCAAACGG - Intergenic
1045666255 8:104488972-104488994 TGTGAGATACGTCAATTAAAAGG + Intergenic
1049853457 8:144847113-144847135 TTTGAGATCTGAGTATCACATGG + Intronic
1050047906 9:1567703-1567725 TGTGAAATCAAAAAATCAAATGG + Intergenic
1050060109 9:1699333-1699355 TTTGAGATTCGAGATTCAAAGGG - Intergenic
1051376860 9:16410728-16410750 GGTGAGATCCGAAGAGCAAAGGG + Exonic
1051859996 9:21613454-21613476 TGTGACATCCTAGATTGAAAAGG - Intergenic
1052208568 9:25872702-25872724 TGTGGGATCTAAAAATCAAAAGG - Intergenic
1055037909 9:71838035-71838057 TGTCAGCTTCTAGAATCAAATGG + Intergenic
1056711314 9:88994158-88994180 TGTGACATCCTGGAATCAGATGG + Exonic
1059599621 9:115762613-115762635 TGTGAAAGCAGAGAATCAGAGGG + Intergenic
1061109339 9:128556868-128556890 TGTTTGATCTGAGAATCAACTGG + Intronic
1061985838 9:134129739-134129761 TGTGAAATCCCAGAAACAATGGG + Intergenic
1187743583 X:22384111-22384133 TGTGATCACCGAGAATCAAAAGG + Intergenic
1190339743 X:49286859-49286881 TGTGAGCTCCCAGGATGAAAAGG + Exonic
1192759856 X:74085880-74085902 TATGAGAGCCTAGACTCAAAAGG + Intergenic
1193857452 X:86622503-86622525 TGTAAGAGACAAGAATCAAAAGG + Intronic
1195203355 X:102571274-102571296 GGTGAGATCTGGGAATCAAGTGG + Intergenic
1195421924 X:104685177-104685199 TGTCAGTTAAGAGAATCAAAAGG - Intronic
1198007060 X:132505827-132505849 TGTGACCTCCCAGAATTAAAAGG + Intergenic
1198093142 X:133351638-133351660 GGTGAGATTGGAGAATCAAATGG - Intronic
1198741174 X:139844680-139844702 TGTGAGATCCCCTAATCCAAAGG + Intronic
1201351417 Y:13046500-13046522 TGAAAGATCCCAGAAGCAAATGG + Intergenic