ID: 963871732

View in Genome Browser
Species Human (GRCh38)
Location 3:150423076-150423098
Sequence GTTCCATTTGAACACGTTAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963871728_963871732 28 Left 963871728 3:150423025-150423047 CCATTTGATTCTCGGATCTCACA 0: 1
1: 0
2: 0
3: 8
4: 131
Right 963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG 0: 1
1: 1
2: 0
3: 11
4: 69
963871730_963871732 0 Left 963871730 3:150423053-150423075 CCTTCAACTGCTTTCTACCAAGC 0: 1
1: 0
2: 1
3: 14
4: 141
Right 963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG 0: 1
1: 1
2: 0
3: 11
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963871732 Original CRISPR GTTCCATTTGAACACGTTAA AGG Exonic
904638615 1:31904189-31904211 GGGCCCTTTGAACAGGTTAAGGG + Intergenic
908384007 1:63623266-63623288 GTCCCTTGTGAACAAGTTAAGGG - Exonic
908878359 1:68702987-68703009 TTTGCTTTTGAACATGTTAAGGG - Intergenic
912828405 1:112927454-112927476 GGTCCAAATGAACAAGTTAAAGG + Intronic
913419456 1:118648987-118649009 ATGCCATTTGAACATGCTAAGGG - Intergenic
915841976 1:159220982-159221004 GCTCCATTTGAACAGGGTCAGGG + Intergenic
918686282 1:187419747-187419769 GTTAGTTTGGAACACGTTAAAGG - Intergenic
923704522 1:236333172-236333194 GTTCGATTTGAACAGGCTACAGG + Intergenic
924600121 1:245481378-245481400 GTTACATTTGAGCACGGGAATGG - Intronic
1065577060 10:27131860-27131882 GTCACCTTTGAACATGTTAAAGG - Exonic
1076194319 10:128504827-128504849 GTAACATTTGAATAAGTTAAGGG - Intergenic
1082105748 11:48219515-48219537 GTTCCTTTTGAACACTTTCATGG + Intergenic
1086075032 11:82841495-82841517 ATTACATTTGAGCATGTTAAAGG - Intronic
1098221320 12:68273045-68273067 GTGCAATTTAAACACCTTAAAGG - Intronic
1105727130 13:23174859-23174881 ATTCCATTTGAAAACCATAATGG - Intergenic
1109232892 13:59780814-59780836 TTTCCTTTTGGACATGTTAATGG + Intronic
1113154031 13:107297440-107297462 CTTCCATTTCTACAAGTTAAAGG + Intronic
1115912467 14:38271557-38271579 CTTCCATGTAAACACTTTAATGG + Intergenic
1118233194 14:63973767-63973789 GTTCCATTTGACTGCCTTAAAGG + Intronic
1120073789 14:80133233-80133255 ATTCAATGTGAACATGTTAAAGG + Intergenic
1126975227 15:54170610-54170632 ATTTCATTTGAACAGGTTAAAGG + Intronic
1126982893 15:54266395-54266417 CTTCTATTTTAACACGTAAAGGG - Intronic
1128145938 15:65332584-65332606 CTTTCATTTGGACAGGTTAACGG + Intronic
1130863488 15:87911511-87911533 GTTCCATTTTCACACAATAAGGG + Intronic
1135530125 16:23245903-23245925 TTTCCATTTAAACACATTAATGG + Intergenic
1141094316 16:81152169-81152191 GTGCCATGTGTACAGGTTAATGG - Intergenic
1142331330 16:89455884-89455906 TTTCCATTTGAACACTTTTTGGG - Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1145874370 17:28305704-28305726 GTTCCATTAGAAACAGTTAAGGG - Intergenic
1150759193 17:67944961-67944983 GCTCCATTTGGACACGCTTAGGG - Intronic
1160330635 18:77988359-77988381 GGTCCATTTCAACCCGTTACTGG + Intergenic
1162694650 19:12464266-12464288 GTTCCATTCGAATACATGAAAGG - Exonic
1163135302 19:15306614-15306636 CTTTCATCTGAACACTTTAAAGG + Intronic
1163700633 19:18785033-18785055 GTTCCATGTGAACACGGTCACGG - Exonic
1164286081 19:23819002-23819024 ATTCCCTTTAACCACGTTAAAGG - Intronic
1164520902 19:28978614-28978636 GTTCCATTTTTACATGTTGATGG - Intergenic
927618446 2:24624613-24624635 GTAGCATTTGAACAAGTAAATGG - Intronic
930373802 2:50538841-50538863 GTTCCATTTGAACTCGAGAATGG + Intronic
933292611 2:80454534-80454556 CTAACATTTGAACACGTTCAAGG - Intronic
935929519 2:108108744-108108766 GTGACATTTGAACATGTTGAAGG + Intergenic
939832886 2:147093979-147094001 GCACCATGTGGACACGTTAAAGG - Intergenic
946183746 2:217965075-217965097 AATCCATTGGAACAGGTTAAGGG + Intronic
947090499 2:226505529-226505551 TTTTCATATGAACAGGTTAAAGG + Intergenic
1170393776 20:15903893-15903915 GTCACTTTTGGACACGTTAAAGG + Intronic
949724282 3:7025393-7025415 CTGCCATGTGAAGACGTTAAGGG + Intronic
952238956 3:31510027-31510049 GTTTCATTTGAACAGCTCAATGG + Intergenic
957879549 3:86193503-86193525 GTTCTATTTGTACACATTAAGGG - Intergenic
958050981 3:88345799-88345821 CTTTCATTTGAACACTTTAGAGG - Intergenic
959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG + Intergenic
961974938 3:131013805-131013827 GTTCCATTTCAGCAAGTTAATGG - Intronic
962069213 3:132015743-132015765 GTTCCATTTGATCCCTTCAATGG - Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
967926903 3:194657361-194657383 GTTCCTTTTAAATATGTTAATGG - Intronic
971775128 4:30953546-30953568 ATTTCATTTGAACACCTTCAAGG + Intronic
974150763 4:58005955-58005977 GTTTCATATGTACATGTTAAAGG - Intergenic
975788622 4:77922856-77922878 GTTCCATTTGGACATCTAAAAGG - Intronic
977996330 4:103500862-103500884 GTTCCATATGAAAAGGTTATTGG + Intergenic
980438469 4:132811856-132811878 TTTTCTTTTAAACACGTTAATGG + Intergenic
983040337 4:162917447-162917469 GTTCCATTTAAACACATTGCTGG + Intergenic
986559838 5:9049546-9049568 GTTCCATGTGAACATGTCAGAGG + Intronic
992214297 5:74510280-74510302 GTTCAATTACAACACTTTAATGG + Intergenic
994050232 5:95354057-95354079 CTTCCATTTGAACAACTTAGTGG - Intergenic
995775625 5:115722303-115722325 GTTACATTTGAAAACATTAAAGG - Intergenic
999961063 5:156756081-156756103 GTTCCTTTTTAACATGTTTAAGG + Intronic
1000954034 5:167521052-167521074 GTTCCATATGACCATGTTATTGG - Intronic
1003976021 6:11345484-11345506 GCTACATTTGAACACCTTAAAGG + Intronic
1007297672 6:40838865-40838887 GTTACATTTGAACAAGTCACTGG - Intergenic
1009566797 6:65320556-65320578 GTGCCACTTGAATACGTTCAAGG - Intronic
1011029851 6:82909976-82909998 GGAGCATTTGAACACGTTGAGGG - Intronic
1011844645 6:91548373-91548395 TCTCCATTTGACCACGTGAATGG - Intergenic
1014151778 6:118065153-118065175 GTTCCATGTGATCACATTAATGG - Intronic
1031395929 7:121273631-121273653 GTTCCATTTGGTCATATTAAAGG - Intronic
1035192779 7:157186785-157186807 GTTCCAGTTGAGCACATTTATGG + Intronic
1037444166 8:18947651-18947673 GATTCATTTGAACCTGTTAAAGG - Intronic
1042330773 8:67578360-67578382 GTTACATTTGAGCACTTTGAGGG - Intronic
1043865531 8:85370866-85370888 GATCCATTTAAACACAATAATGG - Intronic
1056934965 9:90909476-90909498 GTTACTTTTGAACACTTTAACGG + Intergenic
1059507632 9:114814073-114814095 GATGCAGTTGAACACGTAAATGG + Intergenic
1188422185 X:30003667-30003689 GTTTCATTTGAAAATTTTAAAGG - Intergenic
1198944747 X:141998091-141998113 ATTCCATTTGCAAAAGTTAAAGG + Intergenic
1199502631 X:148524912-148524934 GTTCCTTTAGAACACTTAAAAGG - Intronic
1201950869 Y:19562443-19562465 GTTACTTTTGGAGACGTTAAGGG + Intergenic