ID: 963871732

View in Genome Browser
Species Human (GRCh38)
Location 3:150423076-150423098
Sequence GTTCCATTTGAACACGTTAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963871728_963871732 28 Left 963871728 3:150423025-150423047 CCATTTGATTCTCGGATCTCACA 0: 1
1: 0
2: 0
3: 8
4: 131
Right 963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG 0: 1
1: 1
2: 0
3: 11
4: 69
963871730_963871732 0 Left 963871730 3:150423053-150423075 CCTTCAACTGCTTTCTACCAAGC 0: 1
1: 0
2: 1
3: 14
4: 141
Right 963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG 0: 1
1: 1
2: 0
3: 11
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963871732 Original CRISPR GTTCCATTTGAACACGTTAA AGG Exonic