ID: 963874830

View in Genome Browser
Species Human (GRCh38)
Location 3:150463315-150463337
Sequence TTGACATAGGTCAGTCCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963874826_963874830 19 Left 963874826 3:150463273-150463295 CCAAGGCAGAATAGGTTTTGCTA 0: 1
1: 0
2: 0
3: 13
4: 249
Right 963874830 3:150463315-150463337 TTGACATAGGTCAGTCCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 112
963874825_963874830 20 Left 963874825 3:150463272-150463294 CCCAAGGCAGAATAGGTTTTGCT 0: 1
1: 0
2: 1
3: 10
4: 321
Right 963874830 3:150463315-150463337 TTGACATAGGTCAGTCCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963874830 Original CRISPR TTGACATAGGTCAGTCCTGC AGG Exonic
900830588 1:4962522-4962544 TGGGCAGAGGTCATTCCTGCAGG + Intergenic
909210632 1:72818008-72818030 TTGACACACGTGGGTCCTGCAGG + Intergenic
911805761 1:102206007-102206029 TTGATAATGGTCAGTCTTGCAGG + Intergenic
913265934 1:117044291-117044313 TTCACAGAAGTCAGACCTGCAGG - Intergenic
916212552 1:162370661-162370683 TTTATATAGATCAGCCCTGCGGG + Intronic
917030346 1:170683422-170683444 ATGTCCTAGGTCAGTCCTCCAGG - Intronic
923560975 1:235041480-235041502 TTCACATGGGCCAGCCCTGCTGG + Intergenic
923789199 1:237096914-237096936 TTGGAATTGGTCTGTCCTGCAGG + Intronic
924357930 1:243203359-243203381 TTGACTTAGGTCAGTACAGGGGG - Intronic
1063064283 10:2592644-2592666 TTGAGATAAGTGAGTCCTGTGGG - Intergenic
1063469393 10:6272395-6272417 TTGAAATACGTCAGTCTGGCTGG + Intergenic
1064632227 10:17328310-17328332 TTGAAATATGTCAGTCCAGTTGG - Intronic
1068751215 10:60594819-60594841 TTTACAAGGGTTAGTCCTGCTGG + Intronic
1068777886 10:60887746-60887768 TTGTCATGGGTCAGTGCTGAAGG + Intronic
1070901324 10:80031695-80031717 TTTATGTAGGTCAGTCTTGCAGG - Intergenic
1074148705 10:110739742-110739764 TTTCCACAGTTCAGTCCTGCAGG - Intronic
1074681644 10:115913352-115913374 TTGACATAGGGCTACCCTGCAGG - Intronic
1075108203 10:119557436-119557458 TTGACAGAGGTAAGCCATGCAGG - Intergenic
1075604238 10:123792872-123792894 TTGCCTTAGGTCTTTCCTGCCGG - Intronic
1076706797 10:132306894-132306916 GTGACATGGGACAGGCCTGCAGG - Intronic
1080836762 11:35946676-35946698 TAGGCAAAGGTCAGTCCTGGAGG - Intronic
1081335270 11:41857625-41857647 TTGACAGATGACACTCCTGCGGG - Intergenic
1091399995 12:175737-175759 TTTCTATAGGTCAGTCCAGCAGG + Exonic
1092154729 12:6274753-6274775 TTGATGCTGGTCAGTCCTGCTGG + Intergenic
1092466577 12:8738481-8738503 TTCACATAGGTCATTACTTCAGG - Intronic
1103230725 12:119328294-119328316 TTCCTATAAGTCAGTCCTGCAGG + Intergenic
1103881507 12:124169664-124169686 TTGAGATAGCCCAGTGCTGCTGG - Intronic
1104064120 12:125292697-125292719 TTGTCACAGGTCACTCCTGAAGG - Intronic
1106034681 13:26033111-26033133 CAGAGATAGGTCATTCCTGCTGG - Intergenic
1106308588 13:28533940-28533962 ATCACAAAGGCCAGTCCTGCTGG - Intergenic
1112963310 13:105155626-105155648 TTGAAATAGGTCTGTCTTGAAGG + Intergenic
1115106791 14:29771322-29771344 TTGACATAGTTCTGTTCTCCAGG - Intronic
1116144526 14:41047251-41047273 TTGATATAGTTCAGCCTTGCAGG + Intergenic
1118612669 14:67553804-67553826 TTGACTTAGGACAGTCCATCTGG + Intronic
1119298642 14:73553061-73553083 CTGACCTAGGCCTGTCCTGCTGG - Intronic
1119302932 14:73585237-73585259 CTGACCTAGGCCTGTCCTGCTGG - Intergenic
1119887184 14:78152858-78152880 TAGAAATGGGTCAGTGCTGCCGG + Intergenic
1125793073 15:42384520-42384542 TTGACAGATGTCAGTTCTGTTGG - Exonic
1126192247 15:45889834-45889856 TTGATAAAGGTCGGACCTGCAGG + Intergenic
1128239591 15:66092856-66092878 TTGGATTAGGTCAGCCCTGCTGG - Intronic
1128388464 15:67166845-67166867 TGGACGCAGGTCAGTCATGCAGG + Exonic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1138837638 16:60457906-60457928 TTGACATTGGTCATTCTTGCTGG + Intergenic
1145231648 17:21177543-21177565 TTGAAAAGGCTCAGTCCTGCTGG - Intronic
1146295838 17:31649679-31649701 TTTCCACAGGGCAGTCCTGCAGG + Intergenic
1149154841 17:53615550-53615572 TTGACTTAAGTCAATCCTGTAGG - Intergenic
1151558523 17:74859259-74859281 ATGGCAGTGGTCAGTCCTGCAGG + Intronic
1154199098 18:12287248-12287270 TTGCCATAGGGAAGCCCTGCGGG - Intergenic
1155411834 18:25554819-25554841 TGGAAATAAGTCAATCCTGCAGG + Intergenic
1156995410 18:43460190-43460212 TTGTCATTGATCAGTTCTGCTGG + Intergenic
1159733924 18:72070281-72070303 CTAACAAAAGTCAGTCCTGCAGG - Intergenic
1165524620 19:36343513-36343535 TTCACAAAGGCTAGTCCTGCTGG + Intronic
1166500528 19:43337752-43337774 GTGACAAAGGTCACTCCTGCAGG - Intergenic
1166509595 19:43395947-43395969 GTGACAAAGTTCACTCCTGCAGG + Intergenic
1166570080 19:43789982-43790004 CTGTCTTAGGTCAGTCCTGGTGG - Intergenic
1166914688 19:46187079-46187101 TTGAAAGATGTCAGACCTGCTGG + Intergenic
1167269700 19:48499893-48499915 ATGACATTCTTCAGTCCTGCTGG - Exonic
927327290 2:21819670-21819692 ATGACATGGGTCAGTTTTGCTGG + Intergenic
928170258 2:28998816-28998838 TTGGCATAGGTCAGTGCTCGGGG + Intronic
935300566 2:101690340-101690362 GTGACCCATGTCAGTCCTGCTGG + Intergenic
938749466 2:134314790-134314812 TTGAAAGAAGTCAGTCCAGCAGG + Intronic
940638535 2:156326136-156326158 TGGTCACAGGTCAGTACTGCAGG - Exonic
941365789 2:164609495-164609517 ATGATATAGGTTAGTGCTGCTGG - Intronic
942094040 2:172521234-172521256 TTGAATTAGTTCATTCCTGCTGG - Intergenic
944838334 2:203601537-203601559 TTTACATAGGCCAGGCCTGGTGG - Intergenic
1172669863 20:36627534-36627556 TGGACAGAGGTGAGCCCTGCAGG + Intronic
1173416239 20:42858745-42858767 TTGACATCTGTCAGTCCAGTTGG - Intronic
1175422537 20:58843537-58843559 TTTACATAGGTGAGGTCTGCGGG + Intronic
1176905182 21:14491753-14491775 TTGACATAGGACAGACCAACAGG - Intronic
1177326308 21:19593920-19593942 TTGCCACAGGTCACTTCTGCAGG - Intergenic
1180639686 22:17288370-17288392 TTCACCTAGGTCATTCCTTCAGG + Intergenic
1182784516 22:32896042-32896064 TAGACATAGGTCAAGCCTTCTGG + Intronic
949447936 3:4155184-4155206 TTGGCATAGGACTGGCCTGCAGG - Intronic
949870401 3:8583240-8583262 TTGAGAAAGGACAGTCCTGTTGG - Intergenic
954598036 3:51844032-51844054 TTGATATTGGTCAGGCCTGGTGG + Intergenic
956492565 3:69789085-69789107 TTGACATAGGACAGTCTTCTAGG + Intronic
958850505 3:99319279-99319301 ATGACATATGTCCCTCCTGCTGG - Intergenic
963874830 3:150463315-150463337 TTGACATAGGTCAGTCCTGCAGG + Exonic
966910987 3:184559915-184559937 CTGAAAGAGGTCAGTCCTGCTGG - Intronic
970102792 4:12544529-12544551 TTGATAAAGGTCAGTCTAGCTGG - Intergenic
971622697 4:28875876-28875898 TTGACTATGGTCATTCCTGCAGG + Intergenic
976755915 4:88497893-88497915 TTGACATAGTTCTGTCCTCCAGG - Intronic
979243880 4:118476123-118476145 TTGACTTAGGTCAGTACAGGGGG + Intergenic
981946680 4:150353737-150353759 TTGTCATAGGTCAGTCCTTAAGG + Intronic
982206771 4:153002427-153002449 TTGACTTTGGTCAGGCCTTCTGG + Intergenic
984431847 4:179660713-179660735 TTGACATAGTTCTGTCCCTCAGG - Intergenic
986257211 5:6110427-6110449 TTGACATAGGTCTTGCCTCCTGG - Intergenic
989337221 5:40331892-40331914 TGGACACAAGTGAGTCCTGCAGG + Intergenic
990290465 5:54345638-54345660 TGGACATAAGTGGGTCCTGCAGG - Intergenic
993903007 5:93596968-93596990 CTGACAGTGGCCAGTCCTGCGGG + Intergenic
996613314 5:125410454-125410476 TTGACAAAAGTCCGTCTTGCAGG + Intergenic
999529610 5:152448236-152448258 TTGACTTAGGTCAGCCCTCTGGG + Intergenic
1002171186 5:177375410-177375432 TGCACAGAGGTCAGCCCTGCAGG + Intergenic
1003279443 6:4678986-4679008 TTGAGATAGGTGAGCCCAGCTGG - Intergenic
1007474400 6:42109136-42109158 TTTAAATAGGGCAGTCCGGCCGG + Intronic
1015124108 6:129733388-129733410 TTTACATAAGGCAGACCTGCCGG - Intergenic
1023610177 7:41964822-41964844 GTGACACAAGTCAGACCTGCAGG - Exonic
1023741861 7:43288180-43288202 TTGAGAAAGTTCAGTCCTGGTGG - Intronic
1030266340 7:107625945-107625967 TAGACATAGGCCAGGCCTGGTGG - Intronic
1030691552 7:112540229-112540251 TTGACAGAGGTGAGTGCTGTGGG + Intergenic
1038882973 8:31635204-31635226 TTTACATATTTCAGTCCAGCTGG - Intergenic
1039320262 8:36422298-36422320 TTGTCATAGGAGAGTCCTGCTGG + Intergenic
1042004453 8:64165851-64165873 TTTACAAAGTTCATTCCTGCTGG + Intergenic
1044640791 8:94379287-94379309 TTAACTAAGGTCAGTCATGCAGG + Intronic
1046785411 8:118260575-118260597 TTCACAGAGGTCAGGCCTCCAGG - Intronic
1046967342 8:120182362-120182384 TTGACAACAGTCAGCCCTGCAGG - Intronic
1048235125 8:132682424-132682446 TTGACAGTGGTCAGTCATTCAGG - Intergenic
1050657657 9:7847008-7847030 TGGACATAAGTGAGTCCTGCAGG - Intronic
1051306823 9:15718548-15718570 TTGACCTAGTGCAGTCCTACTGG + Intronic
1051805340 9:20986569-20986591 TTGACACAGGTTAGGCCTTCTGG + Intronic
1055209090 9:73767397-73767419 ATCACAAAGGTCAGCCCTGCAGG + Intergenic
1056602789 9:88059465-88059487 ATGATAAAGTTCAGTCCTGCAGG + Intergenic
1062091367 9:134680320-134680342 TGGACTTAGCTCAGTCCTGAAGG + Intronic
1062654035 9:137592880-137592902 TTGACACAGCGCAGTGCTGCGGG + Intergenic
1190133345 X:47771209-47771231 TTATCATAGGTTAATCCTGCTGG + Intergenic
1193968987 X:88026969-88026991 TTCACATAATTCAGTCTTGCAGG + Intergenic
1198710109 X:139492153-139492175 TTGACAGAGCACAGTCCTGAGGG + Intergenic
1199429415 X:147742094-147742116 TTGACACAGGTGTGTCTTGCTGG - Intergenic
1201327224 Y:12775121-12775143 TTAACATAGAGCTGTCCTGCTGG - Intronic
1201464244 Y:14262729-14262751 TTGACACAGGCCTGTCATGCGGG + Intergenic