ID: 963878797

View in Genome Browser
Species Human (GRCh38)
Location 3:150504644-150504666
Sequence GCATCTGCTCAGTTCAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963878797_963878802 19 Left 963878797 3:150504644-150504666 CCTTTCCTGAACTGAGCAGATGC No data
Right 963878802 3:150504686-150504708 ACATAGTAACCCACGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963878797 Original CRISPR GCATCTGCTCAGTTCAGGAA AGG (reversed) Intergenic
No off target data available for this crispr