ID: 963881260

View in Genome Browser
Species Human (GRCh38)
Location 3:150531652-150531674
Sequence AACCCAAGAATTGTTCCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963881259_963881260 0 Left 963881259 3:150531629-150531651 CCTTTTTTAAAAAGGTTATCTAA No data
Right 963881260 3:150531652-150531674 AACCCAAGAATTGTTCCCCTAGG No data
963881257_963881260 29 Left 963881257 3:150531600-150531622 CCATCTCTTAATAAAAGCGTAAA No data
Right 963881260 3:150531652-150531674 AACCCAAGAATTGTTCCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963881260 Original CRISPR AACCCAAGAATTGTTCCCCT AGG Intergenic
No off target data available for this crispr