ID: 963882532

View in Genome Browser
Species Human (GRCh38)
Location 3:150545486-150545508
Sequence CTGTGAGTACAAATTAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963882527_963882532 -2 Left 963882527 3:150545465-150545487 CCTGACCTCCTTTTTGATCTCCT 0: 1
1: 0
2: 1
3: 24
4: 333
Right 963882532 3:150545486-150545508 CTGTGAGTACAAATTAAGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 148
963882526_963882532 4 Left 963882526 3:150545459-150545481 CCAAGACCTGACCTCCTTTTTGA 0: 1
1: 0
2: 1
3: 18
4: 199
Right 963882532 3:150545486-150545508 CTGTGAGTACAAATTAAGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 148
963882525_963882532 19 Left 963882525 3:150545444-150545466 CCAACTGGATCATTACCAAGACC 0: 1
1: 0
2: 2
3: 5
4: 111
Right 963882532 3:150545486-150545508 CTGTGAGTACAAATTAAGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 148
963882529_963882532 -10 Left 963882529 3:150545473-150545495 CCTTTTTGATCTCCTGTGAGTAC 0: 1
1: 0
2: 0
3: 8
4: 162
Right 963882532 3:150545486-150545508 CTGTGAGTACAAATTAAGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 148
963882528_963882532 -7 Left 963882528 3:150545470-150545492 CCTCCTTTTTGATCTCCTGTGAG 0: 1
1: 0
2: 3
3: 13
4: 198
Right 963882532 3:150545486-150545508 CTGTGAGTACAAATTAAGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963882532 Original CRISPR CTGTGAGTACAAATTAAGCT GGG Intronic
901784229 1:11613948-11613970 CTGAGAGAACAAATTCAGGTTGG + Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
909775706 1:79482036-79482058 CTGAAAGTACAAAATTAGCTGGG + Intergenic
910076333 1:83283583-83283605 CTATGAATACATATTATGCTAGG + Intergenic
915012887 1:152705981-152706003 CTGTGAGTAACAAGTACGCTCGG + Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917488610 1:175478194-175478216 CTGTGTATAGAAATTAAACTGGG - Intronic
919524821 1:198634288-198634310 CTGTCCATACAAATCAAGCTGGG - Intergenic
920240160 1:204541104-204541126 TTTTGAGTACAAAATAAGCAAGG - Intronic
921756116 1:218857666-218857688 TTGTGATTAGAAATTAACCTTGG - Intergenic
924897287 1:248355015-248355037 CTCTGATTACAAATTAAACTGGG - Intergenic
1065489975 10:26272962-26272984 CTGTGTGTACAAATAATTCTAGG - Intronic
1066281818 10:33925118-33925140 CAGTGAGTCCAAATAAAGGTGGG - Intergenic
1066327376 10:34376567-34376589 GTTTGAGTACAAATTATGTTAGG - Intronic
1068707047 10:60088584-60088606 CTGAGAATACAAAATTAGCTGGG - Intronic
1069384068 10:67868597-67868619 CTGAAAGTACAAAATTAGCTGGG - Intergenic
1070621142 10:78012201-78012223 CTAAGAGTACAAAATTAGCTGGG + Intronic
1070657013 10:78278635-78278657 CTCTGAGGACAAATTGAGCAAGG - Intergenic
1071208103 10:83307168-83307190 CTGTAAGTACAAGATAAGCCTGG + Intergenic
1071872156 10:89807780-89807802 CTGTGATGACATATTAAGGTTGG - Intergenic
1075940082 10:126383827-126383849 CTGTGAGTAAAAACAAAGGTTGG - Intronic
1076121269 10:127938524-127938546 CTGTGAGTACAAGGCTAGCTTGG + Intronic
1080493385 11:32792427-32792449 CTGTGAGTTCAAAAAAAGTTAGG + Intronic
1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085320739 11:75572412-75572434 CTGTGAGACCAAATTGAGCTAGG + Exonic
1086173851 11:83866526-83866548 CTGTGAGTACTGATTAAGAGGGG + Intronic
1086256234 11:84879909-84879931 CTGTTAGTATAAATTATGCTAGG - Intronic
1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG + Intergenic
1088038833 11:105351318-105351340 TTCTGAGGAGAAATTAAGCTGGG - Intergenic
1089685487 11:120144087-120144109 CTGGTAGTACAAATTGACCTAGG + Intronic
1089956863 11:122579350-122579372 TTGATTGTACAAATTAAGCTTGG - Intergenic
1090479897 11:127058869-127058891 CTATGAGTAAAAATAAATCTGGG - Intergenic
1092179265 12:6434314-6434336 CTGTGAGTACACAGTCAGATCGG + Intergenic
1092464611 12:8719335-8719357 CTGGGATTATAAATTAAGCTGGG + Intronic
1094675850 12:32619718-32619740 CTGTGTGCCCAAATTCAGCTTGG + Exonic
1095279398 12:40332619-40332641 ATGTGAGTACAAAATATCCTGGG + Intronic
1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG + Intergenic
1097278697 12:57830907-57830929 CTGAAAGTACAAAATTAGCTGGG - Intronic
1097363950 12:58690639-58690661 CTGTGTTTGCAAATTTAGCTGGG + Intronic
1104504700 12:129320221-129320243 CTGGGACTACAGATTAAGTTTGG + Intronic
1106884002 13:34163068-34163090 AAGTGAGTACTAATTAAACTTGG + Intergenic
1107831345 13:44376086-44376108 CTTTCATTACAAATTTAGCTGGG - Intronic
1107844924 13:44501907-44501929 ATGTGAGTACAATTTTAGGTAGG - Intronic
1108873355 13:55014461-55014483 TTGTGAGTCCAAATTTAGCATGG - Intergenic
1112516800 13:100060183-100060205 CTGTAAGCAGAAATTAAGCCAGG - Intergenic
1113325619 13:109278325-109278347 CTATGAAGACAAATTAAGCAAGG - Intergenic
1113978427 13:114250329-114250351 CTGTGAATACAAAATTAGCCGGG + Intronic
1115179413 14:30605055-30605077 CTGAAAATACAAAATAAGCTGGG - Intronic
1121258714 14:92550716-92550738 CTGTGAAAACATAATAAGCTGGG - Intronic
1131998046 15:98151833-98151855 GTGTGTGTATAAATGAAGCTGGG + Intergenic
1133081906 16:3328566-3328588 CTGGGAGGACAATGTAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1139796785 16:69489412-69489434 GTGTGATTACTAATTAACCTAGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143545345 17:7591965-7591987 CGGTGAGTAGAAATTCAGGTGGG + Intronic
1145806287 17:27734695-27734717 CTTTGAGTACAAATTATAATGGG + Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1153546588 18:6212854-6212876 ATGTGACTAGAAATTAAGCCAGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156612889 18:38748445-38748467 CTGTAAGGACAGAATAAGCTGGG - Intergenic
1158886426 18:61831289-61831311 CTGTGATTACAGAATCAGCTCGG + Intronic
1164397135 19:27876264-27876286 CTGTGAGGGCTAATTAAGATGGG - Intergenic
1168033961 19:53704021-53704043 TTGAGATTACAAATTAAGATTGG - Intergenic
925558181 2:5154830-5154852 CTGTGAAAGCAAATTAAGCTAGG + Intergenic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
926182203 2:10654893-10654915 CTTTCAATACAAGTTAAGCTGGG - Intronic
928439261 2:31278124-31278146 CTGTGAGCATTAATTAAGCAAGG + Intergenic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
939293728 2:140228932-140228954 CTTTGAGTACAAAAAAAGATGGG + Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
940469105 2:154070754-154070776 CTGACAGTACAAAATTAGCTGGG + Intronic
942513209 2:176724456-176724478 CTGTGAGTAGAAATTAAGTTAGG + Intergenic
942667483 2:178335520-178335542 CTGTGAGTAATAAATAAGCCTGG + Intronic
944088334 2:195875106-195875128 CTTTGAGTATAAATTTATCTTGG + Intronic
944916799 2:204369127-204369149 ATGTGTGTACAAATTAATTTGGG - Intergenic
945397236 2:209334039-209334061 ATGTGAGAACAAAACAAGCTAGG - Intergenic
947519097 2:230830013-230830035 CTGTGAGCACTAAATAAGCCAGG + Intergenic
1170302681 20:14903200-14903222 CTAAGAATACAAATTTAGCTGGG - Intronic
1172503545 20:35444269-35444291 CTGTGAAGAAAAATTAAGCAGGG + Intronic
1173981443 20:47227103-47227125 ATGTGAGTGCAATTAAAGCTAGG - Intronic
1174500823 20:50982662-50982684 CTCTGAGCACAATTTGAGCTGGG - Intergenic
1174868192 20:54158684-54158706 CTGTAAGCACTAATTAAGATAGG - Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181696969 22:24598274-24598296 CTAAAAGTACAAAATAAGCTGGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1184128619 22:42504077-42504099 CTGAAAGTACAAAATTAGCTGGG + Intergenic
1184137413 22:42557392-42557414 CTGAAAGTACAAAATTAGCTGGG + Intronic
950068088 3:10129656-10129678 CTGTCTTTAAAAATTAAGCTTGG + Intergenic
951589892 3:24253053-24253075 CAGTGAATACAAATAAAGGTGGG + Intronic
952163544 3:30720804-30720826 CTGTAAGCACAAATTTAGTTAGG + Intergenic
952790037 3:37193057-37193079 CTGTTAGTATAAATAAACCTGGG + Intergenic
954867033 3:53738377-53738399 CTGTGAGGACAAATCAAGACAGG - Intronic
959057087 3:101577683-101577705 CTAAAAGTACAAATTAAGATGGG - Intronic
959370565 3:105520274-105520296 CTGTGAGTACAAATGTAGGAAGG + Intronic
963882532 3:150545486-150545508 CTGTGAGTACAAATTAAGCTGGG + Intronic
966306103 3:178536659-178536681 CTGTCATTAAAAATTAAGCGTGG + Intronic
969222297 4:5769061-5769083 GTGTGAGAACAAATTAATATAGG - Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
971932603 4:33104582-33104604 CTTTGAGTACAAACTCTGCTGGG + Intergenic
972172638 4:36365457-36365479 CTGTGGGTAAAAATGAAGGTAGG + Intergenic
973169861 4:47128311-47128333 CTGCGAGTCCATCTTAAGCTTGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975547174 4:75571558-75571580 CTGGGTGTAAAAATAAAGCTGGG - Intergenic
976260810 4:83143183-83143205 ATGGGAGTACTAACTAAGCTTGG - Intergenic
980534850 4:134104600-134104622 CTGTGAGCACAAATATAACTAGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981862563 4:149375125-149375147 AGCTGAGTACAAATTAAGCAAGG - Intergenic
983874294 4:172858359-172858381 CTGTGAGTAAATATAAAGCAAGG + Intronic
984428174 4:179614544-179614566 CTGTGAGGACACAGCAAGCTAGG + Intergenic
990318451 5:54606803-54606825 ACGTGAGTACAAATAAAGCTGGG - Intergenic
990497784 5:56366171-56366193 CTGTGAGCACCAATCAACCTGGG + Intergenic
992294475 5:75313899-75313921 CTGAAAATACAAAATAAGCTGGG - Intergenic
994261602 5:97665774-97665796 CTGTGAGCAGAAATGAAGCTTGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994809926 5:104502898-104502920 TTGTTAGAACAAATTAAACTAGG + Intergenic
998796850 5:145829471-145829493 CTGTGTGCTGAAATTAAGCTAGG + Intronic
1000333269 5:160222784-160222806 CTCTGAGTCCCAGTTAAGCTGGG + Intronic
1003553102 6:7116207-7116229 CTGAGACTAGAAATTCAGCTTGG - Intronic
1006429204 6:33984763-33984785 CTGGTAGTTCAAATCAAGCTAGG + Intergenic
1006979327 6:38134053-38134075 CTGTGAGAACCACTTAAGATGGG + Intronic
1008755233 6:54787252-54787274 ATGTGAGTGCAAATAAAACTGGG + Intergenic
1014222626 6:118813432-118813454 CTGTGAGTACAAATTTAGTGTGG - Exonic
1015989308 6:138919751-138919773 CTGTGAATAAAAATAAAGCTGGG - Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1020820644 7:12963374-12963396 CTGTGAGTAGAAATTACCGTTGG - Intergenic
1023525805 7:41101611-41101633 CTGTCTCTTCAAATTAAGCTAGG - Intergenic
1028198766 7:87935987-87936009 CTGTAAGTCCATATTAAGATAGG + Intronic
1032228282 7:130051611-130051633 CTGTCAGTCCAAATTCAGCAGGG + Intergenic
1032493417 7:132342423-132342445 TTGTTATTATAAATTAAGCTGGG + Intronic
1038838159 8:31151785-31151807 CTGTGATTAGAAATTATACTTGG + Intronic
1041065585 8:54079640-54079662 CTGAGAATACAAAATTAGCTGGG + Intronic
1041163930 8:55072640-55072662 CTCTGAGGACAGATAAAGCTGGG - Intergenic
1041316584 8:56569568-56569590 GAGTGAGGACAAAGTAAGCTGGG + Intergenic
1042237145 8:66624697-66624719 CTGTAAGCACAATTTAAGATAGG + Intergenic
1043694081 8:83197620-83197642 GTGTGTGTACAATTTAAGGTGGG - Intergenic
1046614486 8:116461214-116461236 CTGAAAGTAGAAAATAAGCTGGG + Intergenic
1046931868 8:119849243-119849265 CTGAAAGTACAAAATTAGCTGGG + Intronic
1049729068 8:144166689-144166711 CTGTGAGTACAAGTGGGGCTGGG + Intronic
1051326186 9:15972024-15972046 CTGTGATAACAAATAAAACTTGG - Exonic
1052963463 9:34319981-34320003 CTGTGAGACCAAATGGAGCTAGG + Intronic
1053156550 9:35784816-35784838 CTGGGAGTTCAAATTCAGCCTGG - Intergenic
1056075654 9:83036199-83036221 CTGATAAAACAAATTAAGCTTGG + Intronic
1056868563 9:90254577-90254599 CTTTGAGTAAAAATGAGGCTAGG + Intergenic
1057708401 9:97414335-97414357 GTGTGACTTCAAAGTAAGCTTGG + Intronic
1058840657 9:108905279-108905301 CTTTAATTACAAATTAATCTGGG + Intronic
1059054329 9:110962947-110962969 CTGTGAATACACACTAAGGTGGG - Intronic
1059703698 9:116800400-116800422 CTGTGTGCAAAAATTAAGCATGG - Intronic
1059854433 9:118380448-118380470 CTGGGAGTGAAAATTAAGATGGG - Intergenic
1185648908 X:1634499-1634521 CTGTTAGTACAAACTATCCTGGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186533722 X:10325627-10325649 CGGGAAGTACAAATTAATCTAGG + Intergenic
1186792717 X:13014605-13014627 GTGTGAGTTCAAATTCAGATTGG + Intergenic
1187280016 X:17851112-17851134 CTATGAGCACAAACAAAGCTTGG + Intronic
1189843671 X:45110265-45110287 ATGTGAGTACATAGTTAGCTGGG + Intronic
1192210208 X:69123136-69123158 CTGTGTGTACAAATACAGCTTGG - Intergenic
1194530429 X:95041596-95041618 ATGTGAGAAGAAATTAAGCATGG + Intergenic
1196919537 X:120571561-120571583 CTGATACTACAAATTAAGTTTGG - Intronic
1197445664 X:126551075-126551097 GGAGGAGTACAAATTAAGCTGGG + Exonic
1199724958 X:150570488-150570510 ATGTGAGTAAAAATGAGGCTGGG - Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic